Labshake search
Citations for Takara Bio :
5551 - 5600 of 6263 citations for Triiodothyronine T3 ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... the annealed oligo duplex at a 1:3 mol ratio and ligation mix (Takara Bio) at 16 °C for 30 min ...
-
bioRxiv - Biophysics 2020Quote: ... and allowed to bind to cobalt resin (Talon, Clontech; 1 mL bed volume/L culture). The column was washed sequentially with cobalt wash buffer (CoWB ...
-
bioRxiv - Biophysics 2022Quote: HIV-1 Gag (75) was ligated into pEGFP-N1 (Clontech, Takara Bio, Mountain View, CA) to generate the HIV-1 Gag-EGFP vector ...
-
bioRxiv - Biophysics 2022Quote: HIV-1 Gag (75) was ligated into pEGFP-N1 (Clontech, Takara Bio, Mountain View, CA) to generate the HIV-1 Gag-EGFP vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the primers listed in Table 1 with the In-Fusion HD cloning system (Takara). To silence GSK3B expression ...
-
bioRxiv - Biochemistry 2020Quote: ... tricornutum genomic DNA using primers described in Table 1 (Supplemental Information) and Primestar polymerase (Takara) with primers LYS13-LYS16 ...
-
bioRxiv - Biochemistry 2020Quote: ... and the supernatant was mixed with 1 mL of TALON® metal affinity beads (Clontech) previously equilibrated with equilibration buffer (PBS pH 8 ...
-
bioRxiv - Genomics 2019Quote: ... We mixed 2 µg of total RNA with 1 µl 10 mM dNTPs (Clontech #639125) and 1 µl of 50 µM SMART_dT18VN primer (for a complete list of primer sequences ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Microbiology 2020Quote: The HSV-1 copy number was examined by qPCR using SYBR/ROX (RR82LR; Takara, Japan) on ABI qPCR machine (Lifetech ...
-
bioRxiv - Microbiology 2021Quote: ... protein expression was induced with 1 mM of isopropyl-β-D-thiogalactopyranoside (IPTG; Takara Bio) at the final concentration at 25°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Permeabilized cells were then mock treated or treated with 1 mg/ml RNase A (Takara) diluted in PBS for 20 minutes at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... rDA1m was immunostained using a rabbit anti-RFP antibody (1:1000, Takara, cat. number 632496) followed by a Cy3-conjugated donkey anti-rabbit secondary antibody (1:1000 ...
-
bioRxiv - Genomics 2020Quote: ... in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766, Clontech) to maximise the number of individual transformants (800,000 individual clones) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the final volume was increased to 1 mL using SOC medium (cat. no. ST0215, Takara) pre-warmed to 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 150 mM NaCl and 1 mM DTT]23 or CellAmp Processing Buffer (TaKaRa, Kusatsu, Japan) or Lysis Solution of SuperPrep (TOYOBO ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSF-DUET-1-EIF6 construct was used to express eIF6 and the pTf16 (Takara Biosciences) construct was used to express the TF chaperone ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR products and pGEX6P-1 vector were digested with EcoRI (Takara Bio, Shiga, Japan) and NotI (Takara Bio ...
-
bioRxiv - Plant Biology 2022Quote: ... eGFP was immuno detected with anti-GFP antibody (1:4000 dilution) (JL-8, #632380, Takara) and anti- mouse-HRP (1:15000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... was amplified using following primer pairs (AtEH1_1-527_GBD_F GCCATGGAGGCCGAATTCCCAATGGCGGGTCAGAATCCTAACATGG and AtEH1_1-527_GBD_R CTGCAGGTCGACGGATCCCCTTATGCAGAATATCCATT ACCTAGGTGATTAGC) and cloned into the pGBKT7 vector (Clontech). The cytoplasmic part of CLV1 (AA 671 to 980 ...
-
bioRxiv - Cancer Biology 2024Quote: 1 x 106 ACKP cells were transfected with 3 µg pE2F-TA-luc plasmid (Takara) and 0.3 µg renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Neuroscience 2024Quote: ... and resuspended in PBS with 0.3%BSA and 1% recombinant RNase inhibitor (RRI, Takara Bio). Next ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were treated with 200 ng ml−1 of Dox (#631311; TaKaRa, Kusatsu, Japan) for 24 h ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were pre-treated 1 hour prior to the assay with A/C Heterodimerizer (Takara) diluted at 1:200 in complete media concurrent with JF-Halo or -SNAP dye labeling ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by blocking solution containing primary antibodies against mCherry (mouse monoclonal 1:500, Takara Bio) and c-Fos (rabbit polyclonal 1:500 ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... 10 ng cDNA in a 25 μl reaction mixture containing 1 X ExTaq buffer (TaKaRa), 200 μM each of NTP and 800 nM of primers along with 0.625 units ExTaq HS (TaKaRa ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µg of total RNA was converted to cDNA using M-MLV reverse transcriptase (TAKARA) under standard conditions with oligo(dT ...
-
bioRxiv - Microbiology 2023Quote: ... the media was replaced and supplemented with 1 μg/mL aTc (Clontech catalog number 631310). After 24 h induction ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit primary anti-RFP (anti-DsRed Living Colors, 632496, Takara, Mountain View, CA, 1:1000) was followed with donkey anti-rabbit AF594 (715-586-152 ...
-
bioRxiv - Cell Biology 2024Quote: HCT116 cells were transfected with 1µg of either pEGFP Actin vector (Clontech Catalog #6116-1) or pEGFP Actin C374S or pEGFP N1 vector (Clontech Catalog #6085-1 ...
-
Exploratory mass cytometry analysis reveals immunophenotypes of cancer treatment-related pneumonitisbioRxiv - Immunology 2024Quote: ... The resultant cell pellets were then resuspended in Cellbanker 1 cryopreservation solution (Takara, catalog #210409). This suspension was aliquoted into cryovials and gradually frozen to –80°C and stored at –80°C until required for experimental analysis ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA was extracted from pool of 30 embryos at 1 dpf using trizol reagent (Takara), chloroform (Sigma Cat ...
-
bioRxiv - Genetics 2024Quote: ... The detailed protocol was described in the manufacturer’s handbook (Yeast protocols handbook; PT3024-1; Clontech).
-
bioRxiv - Developmental Biology 2021Quote: Full length human COG4 was cloned into pCS2+ vector from plasmid hCOG4-siR-3myc in AAZ6 (Gift from Professor Vladimir V. Lupashin) using In-Fusion® HD Cloning Kit (TaKaRa Bio, 638909) with primers 5’-ATGGGAACCAAGATGGCGGA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: TdT-mediated dUTP nick end labeling (TUNEL) staining was carried out with In Situ Apoptosis Detection Kit (MK500, Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: TdT-mediated dUTP nick end labeling (TUNEL) staining was carried out with In Situ Apoptosis Detection Kit (MK500, Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: ... Purified RNA served as input for the cDNA library preparation with SMART-Seq v.4 Ultra Low Input RNA kit (Takara Bio, Kusatsu, Japan) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... 100 μL cell culture supernatant was harvested for viral RNA extraction using the MINIBEST Viral RNA/DNA Extraction Kit (Takara, Cat no. 9766). RNA was eluted in 30 μL RNase-free water ...
-
bioRxiv - Genomics 2020Quote: ... All of the precipitated RNA was converted into a sequencing library using SMARTer® smRNA-Seq Kit for Illumina (Thermo Fisher/Takara 635032). The kit protocol was used with the following specifics ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was subjected to rRNA depletion using a modified Ribozero method and library preparation using Clontech SMARTer Stranded RNA-Seq Kits (Takara Bio, Shiga, Japan). Sequencing was performed on the Illumina HiSeq2500 100bp PE Rapid run (Ramaciotti Centre for Genomics ...
-
bioRxiv - Genomics 2020Quote: Round 1 PCR amplicons were collected from the ICELL8 chip using the SMARTer ICELL8 Collection Kit: (Collection Fixture, Collection Tube and Collection Film) into a collection and storage tube as per manufacturer’s instructions (Takara Bio USA, CA, USA). 50% of the extracted library was purified twice using a 1X proportion of AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2020Quote: RNA preparations of similar quality from adult mouse testis and sperm were used for constructing PacBio IsoSeq libraries (SMRT bell libraries). Full-length cDNA was synthesized using the Clontech SMARTer PCR cDNA Synthesis kit (Cat. # 634925) (Clontech, Palo Alto, CA). Approximately 13-15 PCR cycles were required to generate 10-15 µg of ds-cDNA from a 1 µg RNA sample ...
-
bioRxiv - Neuroscience 2019Quote: ... The remaining 5′ sequence was obtained by 5′-RACE on medaka brain poly(A)+ RNA using the Marathon cDNA Amplification Kit (Takara Bio, Shiga, Japan), essentially as described previously (Kawabata et al. ...
-
bioRxiv - Microbiology 2019Quote: ... The DNA fragment was introduced to the pKNTG plasmid KpnI and HindIII sites via In-Fusion-HD cloning kit (Takara Bio USA, Inc). We sequenced plasmids and transformed into the ΔFvgbb2 and WT strain resulting in ΔFvgbb2-Gbb2-GFP and FvGbb2-GFP strain ...
-
bioRxiv - Molecular Biology 2019Quote: ... the 5’- and 3’- rapid amplification of cDNA end (RACE) were performed according to the manufacturer’s protocol of the SMART RACE cDNA Amplification kit (Clontech, Mountain View, California, USA). The gene-specific primers are described in Table S8 (1st PCR ...
-
bioRxiv - Plant Biology 2019Quote: RNA was reverse-transcribed and amplified using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech, Mountain View, CA, USA) 21 ...
-
bioRxiv - Immunology 2021Quote: ... or RARα403 (RARα-dAF2) 41 with a C-terminal Halo-tag were generated using the In- Fusion Cloning Kit (TaKaRa Bio Inc, Shiga, Japan). Lentiviruses were generated using CSII-EF- MCS-IRES2-Venus (for overexpression) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized and amplified using template switching technology of the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories, Cat. #R400752), followed by purification using the Agencourt AMPure XP Kit (Beckman Coulter ...
-
bioRxiv - Plant Biology 2020Quote: ... Then the first-strand cDNA synthesis was primed with an oligo (dT) primer by using a PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... a 4.0 kb fragment containing the ERF019 gene and its native promoter was amplified and inserted into pBI101 with BamHI and SacI by In-Fusion HD Cloning Kit (Takara Bio, Shiga, Japan). For awf2 ...