Labshake search
Citations for Takara Bio :
5751 - 5800 of 6263 citations for Triiodothyronine T3 ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng of RNA was used to prepare cDNA sequencing libraries with the Clontech SMARTer Stranded Total RNA-Seq kit (Pico Input) with ribosomal cDNA depletion (Takara Bio USA, Cat #634413). Prepared libraries were submitted to paired-end 100 bp sequencing on a NovaSeq 6000 system at the YCGA ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA carrying full-length transcript information was synthesized with SMART-Seq® v4 Ultra® Low Input RNA Kit for Sequencing (TaKaRa Bio, Japan) followed by Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Plant Biology 2019Quote: ... strategy and internal primers designed from the genomic contigs (Table S1) following the kit supplier’s recommendations (Takara Bio Europe/Clontech, Saint Germain-en-Laye, France). The 3’ ends were amplified using forward internal and polyA-anchored LD primers (Table S1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The PCR product was cloned into pcDNA6/luc/NP3 into a NotI-AgeI site using the Clontech In-Fusion kit (Clontech Laboratories, Mountain View, CA). To remove the two putative MIR211 sites ...
-
bioRxiv - Genomics 2019Quote: ... PCR products were collected by centrifugation at ~2250 xg for 20 min using the supplied SMARTer ICELL8 Collection Kit (Takara Bio USA, Cat.#640048).
-
bioRxiv - Microbiology 2019Quote: ... and then cloned into the pC003 vector by replacing the shahiiCas13a locus using the In-Fusion HD Cloning Kit (Takara Bio, Inc., Shiga, Japan), and then kanamycin resistant gene of the vector was replaced by kanamycin-resistant gene (aphA-3 ...
-
bioRxiv - Biochemistry 2020Quote: Site-directed mutagenesis H >A of the HPGG motif of the Cyt-b5 domain was either performed by Genescript (N. benthamiana) or using In-Fusion® HD cloning kit (Takara Bio, Kusatsu, Japan) for Synechocystis after amplification using two mutagenic complementary primers for amplifying pTHT2031-Ot5H46A-S and pTHT2031-Ot10H20A-S from pTHT2031-Ot5-S and pTHT2031-Ot10-S ...
-
bioRxiv - Genomics 2021Quote: Sequencing libraries were prepared with 50ng input RNA material using SMARTer Stranded Total RNA-seq Kit v2—Pico Input Mammalian (Takara Bio USA Inc., USA), according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... full length double stranded cDNA (dscDNA) was generated using the SMART-Seq version 4 Ultra Low Input kit (Takara Bio USA, Mountain View, CA) and the Nextera XT DNA Library Preparation kit (Illumina) ...
-
bioRxiv - Bioengineering 2020Quote: ... we generated the pAAVS1-HITI-tdT-Fluc2-Oatp1a1-MC (HITI-MC) parental plasmid using the In-Fusion cloning kit from Clontech (Takara Bio, California, USA). Using restriction enzyme digestion ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR fragments were directly cloned into the PacI-linearized expression vectors (pNBI16, pNBI21, or pNBI22) using the In-Fusion® HD Cloning Kit (Takara Bio USA, Inc.). Insert sequences were verified by sequencing (Eurofins ...
-
bioRxiv - Microbiology 2020Quote: ... the V3-V4 regions of the 16S rRNA gene were amplified using a 16S (V3–V4) Metagenomic Library Construction Kit for NGS (Takara Bio Inc, Kusatsu, Japan). The following primers were used (16S rRNA gene-specific sequences are underlined) ...
-
bioRxiv - Plant Biology 2021Quote: ... after which it was used as the template for synthesizing cDNA using the PrimeScript™ II 1st strand cDNA Synthesis Kit (Takara Bio, Beijing, China). The full-length ZmCd1 cDNA was amplified by PCR using Phanta Max Super-Fidelity DNA Polymerase (Vazyme Biotech) ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was normalized to 2ng in a total volume of 9μl and then transcribed to cDNA in a dedicated PCR clean workstation using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio, Mountain View, CA). Sequencing libraries were constructed from cDNA using the SMARTer ThruPLEX DNA-Seq kit (Takara Bio) ...
-
bioRxiv - Biophysics 2022Quote: ... We obtained cDNA from poly(A) RNA of each sample using a SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio Inc., Shiga, Japan), following the manufacturer’s instructions ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: Reverse transcription and cDNA amplification were performed using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio, Kusatsu, Shiga, Japan). The resulting amplified cDNA libraries were assessed for DNA concentration using the Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The α1-subunit genes were inserted at the PH promoter of vectors already containing the corresponding β1-subunit proteins using In-Fusion® HD Cloning Kit (Takara Bio, USA Inc.) and control sequenced ...
-
bioRxiv - Genomics 2022Quote: ... For the Rubicon Genomics ThruPLEX® DNA-seq Kit: High Performance Library Preparation for Illumina® NGS Platforms (currently available from Takara Bio USA), the manufacturer’s protocol was followed.
-
bioRxiv - Biophysics 2022Quote: ... and V2HeR1 was subcloned into a peGFP-P2A vector or pCaMKIIa-eGFP-P2A vector using an In-Fusion HD cloning kit (Takara Bio, Inc., Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... The corresponding full-length cDNA library was then generated using 1μg total RNA and the SMARTer PCR cDNA synthesis kit (Clontech, Takara Bio Inc., Shiga, Japan) following PacBio recommendations set out in the Iso-Seq method ...
-
bioRxiv - Molecular Biology 2020Quote: ... The next two RNA-seq experiments utilized the SMARTer Stranded Total RNA-Seq Kit v2 – Pico Input Mammalian (Takara Bio Inc., Kusatsu, Shiga, JP), and were sequenced on the NovaSeq 6000 (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... Ribosomal RNA was removed from total RNA and libraries were prepared using the Takara SMARTer Stranded Total RNA-Seq Kit v2 (Takara Bio Inc, Shiga, Japan). Samples were sequenced on the NovaSEQ6000 platform on a S4 flow cell using 151-bp paired-end reads at Genomics Shared Resource ...
-
bioRxiv - Neuroscience 2021Quote: Single nuclei library preparation was performed by the MIT BioMicro Center using the SMART-Seq® v4 Ultra® Low Input RNA Kit for Sequencing (Takara Bio Inc) according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The 5’ end of RiMCO1 was verified by rapid amplification of cDNA ends (RACE) using the SMART RACE cDNA amplification kit (Clontech, Palo Alto, CA, USA), the RiMCO1-specific primer GiFETa.rR (Table S2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion and point mutation constructs were produced through inverse PCR using Takara In-Fusion HD cloning kit (#638920) (Takara Bio Inc., Kusatsu, Shiga, Japan). Primers used are listed in supplementary materials.
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was isolated from ten individual mites using Trizol® reagent and was then treated with a PrimeScript™ RT synthesis kit with genomic gDNA eraser according to instructions (TaKaRa, Beijing, China). A 414 base pair (bp ...
-
bioRxiv - Cancer Biology 2021Quote: Reverse transcription and cDNA amplification were performed using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio, Kusatsu, Shiga, Japan). The resulting amplified cDNA libraries were assessed for DNA concentration using the Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... Virus concentration was estimated by p24 titration using the FLAQ assay76 (HIVGKO and VLPs) or the Lenti-X™ p24 Rapid Titer Kit (Clontech; HIVNL4-3/Luciferase).
-
bioRxiv - Developmental Biology 2020Quote: ... Lentiviral supernatant titers were determined by Lenti-X p24 Rapid Titer Kit (supplemental Table 3) according to manufacturer’s protocol (Takara Bio USA, Inc. California, U.S.A).
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated using a template□switch anchored reverse□transcription polymerase chain reaction (RT□PCR) based on the SMARTer pico cDNA PCR Synthesis Kit (Clontech, Mountain View, CA, USA). The final cDNA product was then subjected to a clean□up step using PCR Clean DX Beads (Aline Biosciences ...
-
bioRxiv - Developmental Biology 2021Quote: PCR products were subcloned in frame with GFP sequence in 3′ into pCS2+-GFP vector using In-Fusion® HD Cloning Kit (Takara Bio USA, Inc.). For rescue experiments ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Microbiology 2022Quote: RT-PCR was performed in a single closed tube using a one-step RT-PCR kit (One Step PrimeScript III RT-qPCR Mix, with UNG; Takara Bio Inc., Kusatsu, Japan) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR expression analysis was conducted on cDNA derived from immunoprecipitated RNA of OT:RiboTag mice following reverse (SMARTer® PCR cDNA synthesis kit; Takara Bio Inc., Shiga, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was performed on an ABI Prism 7500 Fast Real-Time PCR System using the SYBR Premix Ex Taq kit (Takara Bio Inc., Shiga, Japan) according to the instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The ATP1A1 genes were inserted at the PPH promoter of vectors already containing the corresponding ATP1B1 genes using In-Fusion® HD Cloning Kit (Takara Bio; Cat#638910) and confirmed by sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA was reverse transcribed in the presence of PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Cat. No. RR047B). For each RT-qPCR reaction ...
-
bioRxiv - Neuroscience 2022Quote: ... Total mRNA was reverse transcribed in the presence of PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Cat. No. RR047B). Droplet digital PCR was used to measure the levels of transcription factors in isolated MG following a previous method (Fisher et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR product was then cloned into pVV16-hsp60 between NdeI and HinDIII using In-Fusion® HD cloning kit (Takara Bio USA, Inc) and Stellar™ competent cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... Section B step 4 in the protocol was modified to account for the incorporation of UDIs (Takara SMARTer RNA Unique Dual Index Kit-96A). A total of 2 uL of each UDI was used instead of the recommended 1 uL each of the 5’ and 3’ PCR primers ...
-
bioRxiv - Biochemistry 2023Quote: ... The PCR fragments of spike protein DNA were cloned into linearized pMRNAXP vector using In-Fusion® HD Cloning Kit (Clontech® Laboratories, Inc.). The cloning mixtures were transformed to One Shot™ TOP10 Chemically Competent E ...
-
bioRxiv - Immunology 2023Quote: Ultra-low input RNA sequencing libraries (from sorted Tgfb1fl/fl;Cx3cr1Cremicroglia) were prepared by using SMART-Seq HT kit for full-length cDNA synthesis and amplification (Takara, San Jose, CA, USA), and Illumina Nextera XT (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... The Genomic and RNA Profiling Core prepared libraries with the Takara SMARTer® Stranded Total RNA-Seq v3 - Pico Input Mammalian kit (Takara, p/n 634485). Using the KAPA Library Quantification kit for Illumina platforms (KAPA Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: Berghia brains (CRG plus rhg) were dissected and put into lysis buffer from the Smart-Seq4 kit (Takara Bio USA Inc., San Jose, CA) and stored at -20°C ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
IRF1 regulates self-renewal and stress-responsiveness to support hematopoietic stem cell maintenancebioRxiv - Cell Biology 2023Quote: ... cDNA generation and amplification were performed using the SMART-Seq® v4 Ultra® Low Input RNA Kit for sequencing (Takara Bio USA, Inc.). Quality check was performed using High sensitivity D5000 ScreenTape® on TapeStation Analysis Software 3.2 (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 µg of quality checked total RNA was converted into first-strand cDNA using a PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa Bio Inc, Shiga, Japan), according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The reporter cassette excised from pPExRF3 and the left and right homology arms were assembled and cloned into a linearized pUC19 in a single enzymatic reaction using the In-Fusion Cloning Kit (Clontech Laboratories Inc., California, U.S.A). A gRNA vector was constructed by cloning a 20-bp target sequence surrounding the stop codon of coronin into pU6 (FlyCRISPR) ...
-
bioRxiv - Biochemistry 2023Quote: ... and the resulting DNA sequences were synthesized (Twist Bioscience, California, USA) and cloned into the pET-28a(+) plasmid using In-Fusion cloning kit (Takara Bio Inc., Shiga, Japan) or the iVEC3 method (58) ...