Labshake search
Citations for Takara Bio :
5251 - 5300 of 5541 citations for Galactose Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Standards for determining copy number of virus stock were prepared using the PrimeScript II High Fidelity One Step RT-PCR Kit (TaKaRa, Cat# R026A) with IAV (H1N1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Constructs that express wrmScarlet-tagged V-ATPase components with gfp::unc-54 3’ UTR were generated using the In-Fusion Advantage PCR cloning kit (Clontech, Cat. #639621). The primers were listed in Extended Data Table 3.
-
bioRxiv - Microbiology 2024Quote: ... The rbp3 gene (slr0193) was amplified and ligated into vector pGEX-6P-1 using the In-Fusion Cloning kit (TaKaRa, Shiga, Japan) and the PCR primers pGEX-6P-1_inv-f/-r and Rbp3_iVEC-f/-r (SI Appendix ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The adjusted samples were subjected to real-time RT-PCR using the One Step SYBR RT-PCR Kit (Takara Corporation, Tokyo, Japan) and the PIKO REAL 96 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Zoology 2024Quote: ... The extracted DNA was sheared to 550 bp target fragments with Covaris M220 and a Illumina library was constructed with a Thruplex DNA-Seq kit (Takara BioRubicon Genomics). Quantification ...
-
bioRxiv - Genetics 2024Quote: ... and 5 μg of the pseudotyping pVSV-G plasmid were co-transfected into HEK293T cells in T75 flasks using CalPhos™ Mammalian Transfection Kit (631312, Takara Bio). The culture medium was replaced 12 hours after transfection with fresh media ...
-
bioRxiv - Microbiology 2024Quote: ... Multiplex reverse transcription-PCR amplification of all 8 influenza virus genome segments was performed on RNA samples using PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara 6210) and primers Uni12/Inf1 (5’-GGGGGGAGCAAAAGCAGG-3’) ...
-
bioRxiv - Cancer Biology 2024Quote: ... a sequencing library was made using 1 ng of sheared cDNA using Low Input Library Prep Kit v2 (Takara Bio Inc, USA). DNA unique Dual index kit was used to combine libraries for sequencing (Takara Bio Inc ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA samples from the patients’s paired tumor tissues and WBCs were used to prepare DNA libraries for DNA sequencing with the ThruPLEX Tag-seq Kit (Takara Bio, USA). The libraries were then pooled and hybridized with pre-designed probes for 95 targeted genes (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... The wild-type AKT1 (NM_001014431.2) was cloned in the pECMV-3×FLAG-N vector using the In-Fusion® HD Cloning Kit (Takara Bio, Cat# 639650). The K20R and K20Q mutant AKT1 plasmids were constructed using the Fast Site-Directed Mutagenesis Kit (TIANGEN ...
-
bioRxiv - Molecular Biology 2024Quote: ... Final NGS libraries were generated using 2ng of the purified 1st PCR product using the dual-indexing Illumina-compatible DNA HT Dual Index kit (Takara #R4000660,R400661). 2nd PCR products were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification of the fragments and their subsequent ligation was performed using the In-Fusion cloning kit and online tools (BD Clontech, Takara Bio, USA), or they were synthesized by GenScript (Piscataway ...
-
bioRxiv - Neuroscience 2024Quote: The samples were rRNA depleted and prepared for sequencing using SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio, France). In brief ...
-
bioRxiv - Molecular Biology 2024Quote: Strand-specific RNA-seq was performed on parental and ibrutinib-resistant Rec-1 cells using SMARTer Stranded Total RNA Sample Prep Kit (Takara, cat# 634873) per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... CASP3 open reading frame and BioID2 either in N-terminus or in C-terminus of CASP3 were inserted into a pcDNA3 vector using the In-Fusion® HD Cloning kit (Takara, 639649) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Complementary oligonucleotides with overhangs were annealed and cloned into the BbsI-digested U6b vector using a DNA ligation kit (Takara Bio, 6023). Sense strand:TTCGGAAGTGCCAATCATCACCTC ...
-
bioRxiv - Microbiology 2024Quote: The purified product and captured beads in upgraded ICDS method were subjected to Illumina library preparation with SMART ChIp-seq kit (Takara, Catalog # 634865) by following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: The purified product in ICDS method and captured beads in upgraded ICDS method were ready for Illumina library preparation with SMART ChIp-seq kit (Takara, Catalog # 634865) by following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR product was cloned into XhoI- and SalI-digested sites of pBluescript SK plasmid using an In-Fusion HD Cloning Kit (Takara Bio Inc.). Afterward ...
-
bioRxiv - Neuroscience 2024Quote: ... All expression plasmids were validated by Sanger DNA sequencing (Azenta Life Sciences) and prepared using Nucleobind Xtra Midi Endotoxin-free prep kits (Takara Cat # 740420.5), following the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2021Quote: Full length human COG4 was cloned into pCS2+ vector from plasmid hCOG4-siR-3myc in AAZ6 (Gift from Professor Vladimir V. Lupashin) using In-Fusion® HD Cloning Kit (TaKaRa Bio, 638909) with primers 5’-ATGGGAACCAAGATGGCGGA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... Purified RNA served as input for the cDNA library preparation with SMART-Seq v.4 Ultra Low Input RNA kit (Takara Bio, Kusatsu, Japan) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... 100 μL cell culture supernatant was harvested for viral RNA extraction using the MINIBEST Viral RNA/DNA Extraction Kit (Takara, Cat no. 9766). RNA was eluted in 30 μL RNase-free water ...
-
bioRxiv - Genomics 2020Quote: ... All of the precipitated RNA was converted into a sequencing library using SMARTer® smRNA-Seq Kit for Illumina (Thermo Fisher/Takara 635032). The kit protocol was used with the following specifics ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was subjected to rRNA depletion using a modified Ribozero method and library preparation using Clontech SMARTer Stranded RNA-Seq Kits (Takara Bio, Shiga, Japan). Sequencing was performed on the Illumina HiSeq2500 100bp PE Rapid run (Ramaciotti Centre for Genomics ...
-
bioRxiv - Genomics 2020Quote: Round 1 PCR amplicons were collected from the ICELL8 chip using the SMARTer ICELL8 Collection Kit: (Collection Fixture, Collection Tube and Collection Film) into a collection and storage tube as per manufacturer’s instructions (Takara Bio USA, CA, USA). 50% of the extracted library was purified twice using a 1X proportion of AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2020Quote: RNA preparations of similar quality from adult mouse testis and sperm were used for constructing PacBio IsoSeq libraries (SMRT bell libraries). Full-length cDNA was synthesized using the Clontech SMARTer PCR cDNA Synthesis kit (Cat. # 634925) (Clontech, Palo Alto, CA). Approximately 13-15 PCR cycles were required to generate 10-15 µg of ds-cDNA from a 1 µg RNA sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... The remaining 5′ sequence was obtained by 5′-RACE on medaka brain poly(A)+ RNA using the Marathon cDNA Amplification Kit (Takara Bio, Shiga, Japan), essentially as described previously (Kawabata et al. ...
-
bioRxiv - Genetics 2019Quote: First strand cDNA was synthesized from 1 μg total RNA by using a PrimeScript RT Reagent Kit with gDNA Eraser (Takara Bio, Kusatsu, Japan). qRT-PCR was performed in a 25 μl reaction volume with SYBR Premix Ex Taq II Tli RNaseH Plus (Takara Bio ...
-
bioRxiv - Genomics 2020Quote: ... Full-length cDNA libraries were constructed from 1 μg of total RNA with SMARTer® cDNA synthesis kit (Takara Bio, Kusatsu, Shiga Japan), utilizing switching mechanism at 5’ end of RNA template (SMART ...
-
bioRxiv - Microbiology 2019Quote: ... The DNA fragment was introduced to the pKNTG plasmid KpnI and HindIII sites via In-Fusion-HD cloning kit (Takara Bio USA, Inc). We sequenced plasmids and transformed into the ΔFvgbb2 and WT strain resulting in ΔFvgbb2-Gbb2-GFP and FvGbb2-GFP strain ...
-
bioRxiv - Molecular Biology 2019Quote: ... the 5’- and 3’- rapid amplification of cDNA end (RACE) were performed according to the manufacturer’s protocol of the SMART RACE cDNA Amplification kit (Clontech, Mountain View, California, USA). The gene-specific primers are described in Table S8 (1st PCR ...
-
bioRxiv - Plant Biology 2019Quote: RNA was reverse-transcribed and amplified using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech, Mountain View, CA, USA) 21 ...
-
bioRxiv - Immunology 2021Quote: ... or RARα403 (RARα-dAF2) 41 with a C-terminal Halo-tag were generated using the In- Fusion Cloning Kit (TaKaRa Bio Inc, Shiga, Japan). Lentiviruses were generated using CSII-EF- MCS-IRES2-Venus (for overexpression) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized and amplified using template switching technology of the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories, Cat. #R400752), followed by purification using the Agencourt AMPure XP Kit (Beckman Coulter ...
-
bioRxiv - Plant Biology 2020Quote: ... Then the first-strand cDNA synthesis was primed with an oligo (dT) primer by using a PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... a 4.0 kb fragment containing the ERF019 gene and its native promoter was amplified and inserted into pBI101 with BamHI and SacI by In-Fusion HD Cloning Kit (Takara Bio, Shiga, Japan). For awf2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Amplified cDNA from the ICELL8® 3’ DE Chip individual cells was collected and pooled using the ICELL8® Collection Kit (Takara Bio) by centrifugation at 3,200 x g ...
-
bioRxiv - Cancer Biology 2020Quote: ... and used to produce low input Illumina Fragment libraries using a Low Input Library Prep kit v2 (Clontech Laboratories, Inc., Catalog No. 634899). DNA was fragmented using the Covaris S220 sonic disruptor and libraries were then sequenced as paired end reads with a read length of 100bp on an Illumina HiSeq 3000.
-
bioRxiv - Plant Biology 2020Quote: ... First-strand cDNA was synthesized from 1 μg total RNA (20 μL reaction volume) using a PrimeScript™ 1st Strand cDNA Synthesis Kit (Takara, Dalian, China) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: ... pChlamiRNA3int (obtained from the Chlamydomonas Resource Center) in between Xho1 and Not1 restriction sites by In-fusion HD EcoDry cloning plus kit (Takara, Cat. No. 638915). A gene fragment encoding three copies of the 9-amino-acid HA epitope followed by EcoR1 and XbaI restriction sites was inserted using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... For iPSC-O differentiation to hepatocyte-like cells (HLC-O): Hepatic differentiation of iPSC-O was performed by Cellartis Hepatocyte Differentiation Kit (Y30050, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... 6 genes were generated as inserts in the shuttle vector puC57 and were subsequently cloned into pDM323 between BglII and SpeI sites using the In-Fusion® HD Cloning Kit (Takara Bio USA) and confirmed by sequencing ...
-
bioRxiv - Microbiology 2021Quote: 5’-RACE PCR was performed on total RNA from VSVg-NL43 infected CD4+ T cells and MDMs following the manufacturer’s protocol for SMARTer® RACE 5’/3’ Kit (Takara Bio, Cat: 634858). Random primers were annealed to template RNA using 10X Random Primer Mix ...
-
bioRxiv - Microbiology 2021Quote: ... The LAMP1 gene was then sub cloned into the pEF1α-mCherry-N1 vector using the In-Fusion® HD Cloning Kit (Clontech, Takara, Japan), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: pEX18Tc-hpdA was constructed for gene knockout by fusing the erythromycin resistance gene and two upstream and downstream fragments of the target gene amplified with the primers shown in Table 3 to Sac I/Hind III-digested pEX18Tc with the In-Fusion® HD Cloning Kit (TaKaRa, Dalian, China). The resulting plasmid pEX18Tc-hpdA was transformed into E ...
-
bioRxiv - Microbiology 2020Quote: ... The amplification of viral DNA by PCR was carried out base on the manufacturer’s recommendations of the LA PCR Kit (TaKaRa Biomedical Technology Beijing, China). Briefly ...
-
bioRxiv - Microbiology 2020Quote: The lentivirus-based expression plasmids were generated with a pLOV-CMV-GFP vector (Neuron Biotech, China) using In-Fusion HD Cloning kits (Clontech Laboratories, Inc., USA), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... or its derivatives with appropriate antibiotics resistant genes (ampicillin for Escherichia coli and neomycin or puromycin for mammalian cells) and a tag (SNAP-tag or HaloTag) using an In-Fusion HD Cloning Kit (639635, Takara Bio, Shiga, Japan). The E ...