Labshake search
Citations for Takara Bio :
5201 - 5250 of 5541 citations for Galactose Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The amplified fragments required to generate the chimeric receptor were combined with a linearized pCS2+ backbone and annealed using an In-Fusion kit (Takara Bio, 638947). The resulting plasmids were transformed into Top10 chemically competent cells ...
-
bioRxiv - Biochemistry 2023Quote: ... 1,5 µg of plasmid DNA and 1,5 µg pOG44 (encoding the Flp recombinase) were mixed and transfected using CalPhos Mammalian Transfection Kit (Clontech®/Takara, #631312). The transfection medium was replaced by complete DMEM after 24 h ...
-
bioRxiv - Immunology 2023Quote: ... Genomic DNA samples from the patients’s paired tumor tissues and WBCs were used to prepare DNA libraries for DNA sequencing with the ThruPLEX Tag-seq Kit (Takara Bio, USA). The libraries were then pooled and hybridized with pre-designed probes for 95 targeted genes (Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a modified pCaSpeR4 vector containing the αTub84B promoter (Marois et al., 2006) using In-Fusion cloning kit (Takara Bio, Japan). Forward primer sequence was 5’-CTAGAGGATCCCCGGGTACCATGGTGAGCAAGGGCGAG-3’ and reverse primer sequence was 5’-TCGAGGGGGGGCCCGGTACCTTAATTGTAAGTAATACTAGATCCAGGGTATAAAGTT GTTC-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of total RNA was used to make cDNA libraries using prime script RT reagent kit gDNA eraser (Takara Bio Inc.) according to the kit’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... The DNA product was purified from the gel slice using the PCR cleanup and gel extraction kits (740609.50, Takara Bio, Kusatsu, Shiga). The purified DNA was cleaned using AMPure XP (A63881 ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... The C-terminus of Rtl9 was fused to a 4x GGS linker (ggaggatcaggaggatcaggaggatcaggaggatca)-attached mCherry by means of a cloning enzyme (In-Fusion® HD Cloning Kit, Takara Bio). The purified targeting vector was assessed for its quality by Sanger sequencing and injected into mouse pronuclei at the final concentration of 10 ng/μl ...
-
bioRxiv - Evolutionary Biology 2023Quote: The 3’UTR sequence of CcTRPM gene was amplified by the 3’-Full RACE Core Set with PrimeScriptTM RTase kit (Cat# 6106, Takara, Kyoto, Japan). miRNAs for CcTRPM were predicted by a service provider LC science with two software programs of miRanda (http://www.microrna.org ...
-
bioRxiv - Cell Biology 2023Quote: The cDNA of sorted tdTomato positive hair cells was synthesized using PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time, RR047A, Takara Bio). Synthesized cDNA was subsequently mixed with qPCR primers and TB Green Premix Ex Taq (Tli RNase H Plus ...
-
bioRxiv - Biochemistry 2023Quote: The DNA sequences corresponding to M.EcoGII and SUPREM were inserted into the pCDNA3.1-eGFP-GSx3 plasmid using the In-Fusion cloning kit (Takara Bio Inc., Shiga, Japan), resulting in a sequence encoding eGFP with a flexible linker sequence (GGGGS)3 linked to the N-terminus of the methyltransferase.
-
bioRxiv - Molecular Biology 2023Quote: ... Accurate quantification of mRNA levels was meticulously conducted by employing the GAPDH reference gene and utilizing the cutting-edge SYBR Green kit (Takara, Kyoto, Japan) on the state-of-the-art Real-time PCR Detection System manufactured by Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... levels were measured by a qRT-PCR assay using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (TaKaRa, Cat# RR096A). The PCR protocol was 42°C for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were cultured again overnight and subjected to the quantification of mRNA by qRT-PCR using the CellAmp Direct RNA Prep Kit for RT-PCR (Real Time) (3732, Takara Bio Inc.), One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR fragment was subcloned into the KpnI-NotI site of the pCAGGS vector20 using In-Fusion HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the PCR products were subcloned into EcoRV site of pBluescript SK- vector using In-Fusion® HD Cloning Kit (TaKaRa Bio, Japan) and sequenced with the M13 forward primer (5’-GTAAAACGACGGCCAG-3’ ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The PCR products were used as templates to synthesize specific dsRNA using the in vitro Transcription T7 Kit (TaKaRa Biotechnology, Dalian, China) (dsRNA-Vitro ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated DNA was amplified by PCR using Hot Start TaKaRa LA Taq kit to yield a 10-Kb product (Takara Biotechnology, #RR042A). Primers utilized were the following ...
-
bioRxiv - Biophysics 2023Quote: Retroviral constructs encoding HA3-CXCR4 wild-type or designed variants were generated using the In-Fusion HD Cloning Kit (Takara, ref: 638933). Sequences of interest from the expression constructs mentioned above were amplified by high-fidelity PCR (CloneAmp HiFi PCR Premix ...
-
bioRxiv - Plant Biology 2023Quote: ... The expression of marker genes was detected by qRT-PCR using the One-step TB Green PrimeScriptTM RT-PCR kit II (Takara, Osaka, Japan). All genes were normalized against the level of an actin reference gene (Foo et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR fragment was subcloned into the KpnI-NotI site of the pCAGGS vector10 using In-Fusion HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragmented RNA was used to produce barcoded cDNA sequencing libraries using the SMARTer® Universal Low Input RNA Kit (Takara, 634938). Short-read libraries were sequenced on Illumina NovaSeq S4 (paired-end 2×150) ...
-
Mice generated with induced pluripotent stem cells derived from mucosal-associated invariant T cellsbioRxiv - Immunology 2023Quote: ... and resultant RNAs (10 ng per sample) were subjected to cDNA library construction (SMARTer Mouse TCR a/b profiling kit, Takara Bio, Japan). The next generation sequencing was performed with MiSeq (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were subcloned into pcDNA5 FRT/TO HA FLAG Hu Jaw1 or pcDNA5 FRT/TO Hu Jaw1 (digested with HpaI/XhoI) using an In-Fusion HD Cloning Kit (#Z9648N; TaKaRa, Kusatsu, Japan), resulting in pcDNA5 FRT/TO HA FLAG Hu Jaw1 opsin ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were subcloned into the pcDNA5 FRT/TO HA FLAG Ms Jaw1 (digested with HpaI/SphI) by double-insert cloning using an In-Fusion HD Cloning Kit (#Z9648N; TaKaRa, Kusatsu, Japan), resulting in pcDNA5 FRT/TO HA FLAG Ms Jaw1 504–508A ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were subcloned into the pcDNA5 FRT/TO HA FLAG Ms Jaw1 (digested with HpaI/BamHI) using an In-Fusion HD Cloning Kit (#Z9648N; TaKaRa, Kusatsu, Japan). Similarly ...
-
bioRxiv - Cell Biology 2022Quote: ... and the DNA fragments were ligated to the pcDNA5 FRT/TO HA FLAG vector (digested with the same enzymes) using a DNA Ligation Kit (#6023; TaKaRa, Kusatsu, Japan), resulting in pcDNA5 FRT/TO HA FLAG Hu sec11a and pcDNA5 FRT/TO HA FLAG Hu sec11c ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were subcloned into the pcDNA5 FRT/TO HA FLAG Ms Jaw1 (digested with AfeI/BamHI) using an In-Fusion HD Cloning Kit (#Z9648N; TaKaRa, Kusatsu, Japan) to swap the luminal region of Jaw1 to that of KASH proteins ...
-
bioRxiv - Cell Biology 2022Quote: ... and the DNA fragments were ligated into the pcDNA5 FRT/TO HA FLAG vector (digested with same enzymes) using a DNA Ligation Kit (#6023; TaKaRa, Kusatsu, Japan), resulting in pcDNA5 FRT/TO HA FLAG Ms Jaw1 PA and pcDNA5 FRT/TO HA FLAG Ms Jaw1 NIDR PA ...
-
bioRxiv - Cell Biology 2022Quote: ... The pcDNA5 FRT/TO HA FLAG Hu AASS was then digested with BamHI/ApaI and the DNA fragment was ligated into the pcDNA5 FRT/TO vector using a DNA Ligation Kit (#6023; TaKaRa, Kusatsu, Japan), resulting in pcDNA5 FRT/TO Hu AASS ...
-
bioRxiv - Immunology 2023Quote: ... 110 ng of RNA were retrotranscribed in a final volume of 10 μL using the PrimeScript RT reagent Kit (Takara, Kusatsu, Japan) with a combination of oligo-d(T ...
-
bioRxiv - Immunology 2023Quote: ... 20ng of total RNA was used for the cDNA synthesis and amplification with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara, cat#634889) according to instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then the same amount of RNA/H2O mix (containing 1 μg of total RNA) from each sample was reverse-transcribed to cDNA using the EcoDry cDNA synthesis kit (Takara Bio, #639548) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... TE cells were used as input to generate full length cDNA with the SMART-SeqTM v4 UltraTM Low Input RNA Kit (Clontech Laboratories, Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... The cDNA was synthesized from 400 ng of DNase-treated total RNA by the Takara PrimeScript RT Reagent Kit with gDNA Eraser (Takara bio RR047B). Quantitative PCR was performed using TB Green™ Premix Ex Taq™ (Tli RNaseH Plus ...
-
bioRxiv - Cell Biology 2023Quote: ... MA) and PrimeScript RT reagent kit with gDNA Eraser and SYBR Premix Ex Taq II (Tli RNase H Plus) (TaKaRa, Kusatsu, Japan) (Taniguchi and Yoshida ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared from total RNA using the Smarter® Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara Bio 634411) and sequenced on a Novaseq 6000 ...
-
bioRxiv - Cell Biology 2023Quote: ... the following combinations of gRNAs and complimentary adaptor ligated expression cassettes were transfected into the F1 mESCs using Xfect transfection kit (Takara, Cat.No.631317).
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR was performed to detect expression of genes was using the SYBR® Premix Ex Taq kit (Takara, Japan) according to the manufacturer’s instructions and an iQ™5 real-time PCR System (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared for sequencing using the SMARTer Stranded Total RNA-seq Kit v2 (cat# 634413) – Pico Input Mammalian (Takara Bio USA). RNA samples were first synthesized into cDNA ...
-
bioRxiv - Plant Biology 2023Quote: Total RNAs from inflorescences or seedlings were treated with DNase I followed by reverse transcription using PrimeScript™ II 1st Strand cDNA Synthesis Kit (TAKARA, 6210A) with oligo-d(T ...
-
bioRxiv - Genetics 2023Quote: ... The full-length cDNAs of SUH1 and BC10 were amplified using the Taq LA DNA polymerase PCR kit from Takara (https://takara.com/) with cDNA-specific primers (Supplementary Table S2) ...
-
bioRxiv - Bioengineering 2023Quote: ... cDNA was reverse transcripted from 500ng RNA using PrimeScript™ II 1st strand cDNA Synthesis Kit (Catalog # 6210A TAKARA BIO, Kusatsu, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... and the resulting PCR product was cloned into the epiGreenB5 (3xHA) and epiGreenB (eGFP) vectors between the ClaI and BamHI restriction sites with an In-Fusion HD Cloning Kit (Clontech, CA, USA) (Nekrasov et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... Synthesis of cDNA using reverse transcriptase was performed with the RNA to cDNA EcoDry Premix kit (Takara Bio, San Jose, CA; 639549) and and the subsequent quantitative PCR using PowerSYBR Green (Applied Biosystems - Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... The size ranges from 27 nt to 30 nt was cut and thus obtained RNA fragments were subjected into library generation using Smarter smRNA-Seq kit (Takara Cat# 635031).
-
bioRxiv - Biochemistry 2023Quote: ... Expression plasmids for other His-mCherry or His-GFP fusion proteins were constructed using in-Fusion HD Cloning Kit (Takara Bio, Inc.). All mCherry/GFP fusion proteins were expressed in E ...
-
bioRxiv - Genomics 2023Quote: ... and 1 ng of embryonic total RNA from rabbits and cattle were reverse transcribed using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara Bio, Japan) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... vRNA copy numbers of each virus stock were measured via RT-qPCR assay with the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (TaKaRa, Cat# RR096A) as described previously [12] ...
-
bioRxiv - Plant Biology 2024Quote: ... A total of 2 ug of the total RNA from each sample were used to synthesize the cDNA using PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: The pCAG-MDM4 expression vector was established by cloning of MDM4 sequence into a pCAG vector47 containing a multiple cloning site (pCAG-MCS) using In-Fusion® Snap Assembly Starter Bundle kit (#638945; Takara Bio). A single restriction digest was performed on the pCAG-MCS vector using XhoI (Cat ...