Labshake search
Citations for Takara Bio :
5151 - 5200 of 5541 citations for Galactose Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... the plasmids were cleaved using restriction enzymes and purified using electrophoresis and NucleoSpin Gel & PCR Clean-up kit (Takara bio, Shiga, Japan). The copy number of each standard DNA was calculated based on the concentration quantified with the Qubit 3 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... the RNAs of 150µl of the supernatant were extracted and quantified using Retro-X™ qRT-PCR Titration Kit (Takara, cat# 631453), according to the manufacturer instruction.
-
bioRxiv - Bioengineering 2022Quote: ... All the fragments were ligated sequentially and inserted into XhoI site on pABpaR2pX by In-Fusion HD Cloning Kit (Clontech Laboratories, Inc.) To generate the transfer vector for NA9-Bac ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 ng of total RNA was amplified and converted to cDNA using the SMART-Seq v4 Ultra Low Input RNA kit (Clontech Ref. 634889). Afterwards ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA were amplified from the embryo RNA using PrimeScript™ II High Fidelity One Step RT-polymerase chain reaction (PCR) Kit (Takara, R026A) using the following primers ...
-
bioRxiv - Immunology 2022Quote: ... TCR α- and β-chain genes were reverse transcribed and amplified from the RNA using the SMARTer RACE Kit (Clontech Laboratories, Inc). The amplified TCR genes were sub-cloned into the pEF- 1α/pENTR vector (Addgene ...
-
bioRxiv - Genomics 2022Quote: We prepared stranded RNA-Seq libraries for each plasma fraction using Clontech SMARTer stranded total RNA-seq kit v2-pico input mammalian (Takara Bio, 634414) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... was reverse-transcribed into the first-strand cDNA in a 20 μl reaction volume using the first strand cDNA synthesis Kit (TaKaRa, Dalian, China). PCR amplification were 94℃ for 3 min ...
-
bioRxiv - Plant Biology 2022Quote: Full-length CDSs of CiS40-11 was cloned into the expression vector pCanG-HA and pCAMBIA1302 using In-Fusion® HD Cloning Kit (TaKaRa, Japan). All generated binary plasmids were confirmed by enzyme digestion and sequencing validation ...
-
bioRxiv - Molecular Biology 2022Quote: ... was purchased from Eurofins Genomics and inserted in the C-termini of GFP with the In-Fusion HD cloning kit (Takara Bio USA). All primers used for the plasmid construction are listed in Table 3.
-
bioRxiv - Microbiology 2022Quote: ... These PCR products were then assembled and cloned into a plasmid pAPT110 linearized with NheI using the In-Fusion® HD cloning kit (Takara Bio) to generate plasmid p4G39 ...
-
bioRxiv - Microbiology 2022Quote: ... all RNA preparations were subjected to a second DNase treatment using the genomic DNA (gDNA) Eraser (Perfect Real Time Kit, Takara Biochemicals, China). RNA concentrations were quantified on a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... 10 ng RNA were used and 7 PCR cycles were carried out to synthesise cDNA with the SMART-Seq® v4 Ultra® Low Input RNA Kit (cat # 634891, Takara). RNAseq libraries were prepared with the Nextera XT DNA Library Preparation Kit (cat# FC-131–1096 ...
-
bioRxiv - Microbiology 2022Quote: ... The Apollo 324 NGS Library Prep System was used with the PrepX RNA-seq library preparation kit (Takara Bio, San Jose, CA). Sequencing was performed on Illumina NovaSeq 6000 platform (SP 100nt Lane ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting probe reaction mixtures were electrophoresed on a 0.8% agarose gel for 30 min at 100 V and then gel purified with a NucleoSpin Gel and PCR Clean-up kit (Takara Bio USA). The EMSA binding reaction ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Total RNA was extracted from the whole bodies of a pool of 15 AM-treated larvae using the TaKaRa MiniBEST Universal RNA Extraction Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNAs were synthesized using 3 µg each of the total RNA and PrimeScript 1st strand cDNA synthesis kit (Takara, Kusatsu, Shiga, Japan). Exon spanning primes were made ...
-
bioRxiv - Physiology 2022Quote: ... samples were rRNA depleted utilizing the RiboGone Mammalian-Low Input Ribosomal RNA Removal Kit (Takara Bio USA Inc., Mountain View, CA, USA), and Agencourt AMPure XP SPRI beads (Beckman Coulter) ...
-
bioRxiv - Physiology 2023Quote: ... cDNA was made from 100-400 ng of DNase-treated total RNA using a Takara PrimeScript RT Reagent Kit with gDNA Eraser (Takara bio RR047B). Quantitative PCR was performed using TB Green™ Premix Ex Taq™ (Tli RNaseH Plus ...
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Immunology 2022Quote: Extracted RNA was thawed on ice and converted to first strand complementary DNA (cDNA) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA), as described by the manufacturer and a custom oligonucleotide that contained the template switch oligo and a unique molecular identifier (5’ TSO-UMI ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and inputted into cDNA synthesis by incubation with a mixture of random hexamers and reverse transcriptase (TAKARA PrimeScript RT Reagent Kit with gDNA Eraser, Takara Bio #RR047A). The resulting cDNA was diluted 1:10 and 2 μl of each sample was amplified using a QuantStudio 5 (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...
-
bioRxiv - Molecular Biology 2022Quote: ... and libraries were prepared with a SMART-Seq Stranded Kit according to the user manual (Takara Bio USA, Mountain View, CA, USA). In brief ...
-
bioRxiv - Plant Biology 2023Quote: ... The resulting fragments were cloned into vector backbones derived from pPY22 (mNeonGreen-Hygromycin B) or pPY23 (mNeonGreen-Nourseothricin) using the In-Fusion Snap Assembly Kit (Takara, cat. 638948). For PpREN knockout ...
-
bioRxiv - Cell Biology 2024Quote: ... SMART-Seq v4 Ultra Low Input Kit for Sequencing was used for full-length cDNA synthesis and amplification (Clontech, Mountain View, CA), and Illumina Nextera XT library was used for sequencing library preparation ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA extracted from the gonads underwent reverse transcription after concentration adjustment with the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Japan).
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA prepared from adult mouse livers was reverse-transcribed using a PrimeScript II first-strand cDNA Synthesis Kit (Takara, Shiga, Japan) with a random hexamer primer ...
-
bioRxiv - Molecular Biology 2024Quote: The full length BRD4 DNA fragment was amplified by PCR from pcDNA4-TO-HA-BRD4FL (Addgene plasmid #31351)61 incorporated into linearized FM5 lentiviral vectors containing standardized linkers (generously provided by David Sanders) using the In-Fusion HD cloning kit (Takara Bio, 638910). BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Genetics 2024Quote: ... GFP-fused Actb WT and S348L in pcDNA3-GFP were amplified using KOD One (TOYOBO, Osaka, Japan) and cloned into pCSf107mT[31] using the In-Fusion HD Cloning Kit (Takara, Shiga, Japan) resulting in pCSf107mT-GFP-Actb WT and S348L ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA with mutations or deletion were constructed by site-directed mutagenesis using PrimeSTAR® HS DNA Polymerase mutagenesis kit (Takara Bio, Japan) following to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were analysed by gel electrophoresis and positive products were purified using the NucleoSpin Gel and PCR clean up kit (Clontech, Takara Bio) before being sent for sequencing by Eurofins Genomics (Germany) ...
-
bioRxiv - Genomics 2024Quote: ... and one microgram of the DNase-treated RNA was used for cDNA synthesis using PrimeScript RT reagent kit (Takara Bio, CA, USA). The expression analysis was performed using TB green Premix Ex Taq II (Takara Bio ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were generated and sequencing was performed by the NY Genome Technology Center with a low input SMART-Seq HT with Nxt HT kit (Clontech Laboratories, 634947) and SP100 cycle flow cell ...
-
bioRxiv - Genomics 2024Quote: We applied three distinct cDNA library enrichment protocols for the RNA sample extracted from the same mice individual: i) standard PacBio Clontech SMARTer PCR cDNA Synthesis kit (Clontech Laboratories, Inc.); ii ...
-
bioRxiv - Immunology 2023Quote: ... and used to generate Illumina-ready heavy and light chain sequencing libraries using the SMARTer Mouse BCR IgG H/K/L Profiling Kit (Takara, Cat# 634422). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... MYCN 5′ DEL and 3′ DEL deletion mutants were generated by restriction-free cloning using plasmid PCR amplification and overhang ligation using the In-Fusion Cloning Kit (Takara Bio 638910) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were cloned into a PCR linearized pEcgRNA-guide plasmid to make the pEcgRNA-guide-RT plasmid using In-fusion® HD-cloning kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: The q-PCR standards were synthesized by cloning target genes into Escherichia coli DH5a using a PMD18-T vector Cloning Kit (TaKaRa Biotechnology, China). Vector concentrations were measured using NanoDrop ...
-
bioRxiv - Pathology 2024Quote: First strand cDNA was generated from 1 μg of total RNA using the Prime Script RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). Real-time PCR was performed by using an SYBR Green PCR Master Mix (TaKaRa ...
-
bioRxiv - Developmental Biology 2023Quote: ... and libraries were prepared as described previously with the following modifications: Libraries were prepared using the SMART-seq v4 Plus/ultra-low RNA input stranded total RNA-seq kit (Takara Bio Inc.) and sequenced on the NextSeq 1000/2000 (100 cycles ...
-
bioRxiv - Immunology 2023Quote: Full length cDNAs were generated and amplified directly from a single cell through the SMART-Seq HT Kit (Takara Cat. No. 634437). Up to 200pg cDNAs were used to generate the dual index Illumina libraries using Nextera XT DNA Library Prep Kit (Illumina Cat No ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg RNA was subsequently converted to cDNA using random hexamer primer using PrimeScript™ 1st strand cDNA Synthesis Kit (Takara Bio) in accordance with manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Neurons were transfected with GCaMP6 or NEMO-encoding plasmids at 7 to 9 days after plating using a calcium phosphate transfection kit (Takara Bio Inc).
-
bioRxiv - Microbiology 2023Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... the two fragments were introduced into a pHSG397 derivative carrying tesB and scdL1 using the In-Fusion HD Cloning Kit (TaKaRa Bio, Japan). This yielded the pHSGScdL2NY-Kmr plasmid carrying tesB ...
-
bioRxiv - Cell Biology 2023Quote: ... Individual master mixes for each gene of interest were prepared using the TB Green® Premix Ex Taq II (TLi RNaseH Plus) reagent kit (RR820A, Takara Bio) and primer sets ordered from Sigma-Aldrich (Supplementary Table 2) ...