Labshake search
Citations for Takara Bio :
5001 - 5050 of 5321 citations for Human Lysine K Specific Demethylase 1A KDM1A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... TE cells were used as input to generate full length cDNA with the SMART-SeqTM v4 UltraTM Low Input RNA Kit (Clontech Laboratories, Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... The cDNA was synthesized from 400 ng of DNase-treated total RNA by the Takara PrimeScript RT Reagent Kit with gDNA Eraser (Takara bio RR047B). Quantitative PCR was performed using TB Green™ Premix Ex Taq™ (Tli RNaseH Plus ...
-
bioRxiv - Cell Biology 2023Quote: ... MA) and PrimeScript RT reagent kit with gDNA Eraser and SYBR Premix Ex Taq II (Tli RNase H Plus) (TaKaRa, Kusatsu, Japan) (Taniguchi and Yoshida ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared from total RNA using the Smarter® Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara Bio 634411) and sequenced on a Novaseq 6000 ...
-
bioRxiv - Cell Biology 2023Quote: ... the following combinations of gRNAs and complimentary adaptor ligated expression cassettes were transfected into the F1 mESCs using Xfect transfection kit (Takara, Cat.No.631317).
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR was performed to detect expression of genes was using the SYBR® Premix Ex Taq kit (Takara, Japan) according to the manufacturer’s instructions and an iQ™5 real-time PCR System (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared for sequencing using the SMARTer Stranded Total RNA-seq Kit v2 (cat# 634413) – Pico Input Mammalian (Takara Bio USA). RNA samples were first synthesized into cDNA ...
-
bioRxiv - Plant Biology 2023Quote: Total RNAs from inflorescences or seedlings were treated with DNase I followed by reverse transcription using PrimeScript™ II 1st Strand cDNA Synthesis Kit (TAKARA, 6210A) with oligo-d(T ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR fragment was subcloned into the KpnI-NotI site of the pCAGGS vector10 using In-Fusion HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Biochemistry 2023Quote: ... 1,5 µg of plasmid DNA and 1,5 µg pOG44 (encoding the Flp recombinase) were mixed and transfected using CalPhos Mammalian Transfection Kit (Clontech®/Takara, #631312). The transfection medium was replaced by complete DMEM after 24 h ...
-
bioRxiv - Immunology 2023Quote: ... The DNA product was purified from the gel slice using the PCR cleanup and gel extraction kits (740609.50, Takara Bio, Kusatsu, Shiga). The purified DNA was cleaned using AMPure XP (A63881 ...
-
bioRxiv - Microbiology 2023Quote: Standards for determining copy number of virus stock were prepared using the PrimeScript II High Fidelity One Step RT-PCR Kit (TaKaRa, Cat# R026A) with IAV (H1N1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Synthesis of cDNA using reverse transcriptase was performed with the RNA to cDNA EcoDry Premix kit (Takara Bio, San Jose, CA; 639549) and and the subsequent quantitative PCR using PowerSYBR Green (Applied Biosystems - Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... and the resulting PCR product was cloned into the epiGreenB5 (3xHA) and epiGreenB (eGFP) vectors between the ClaI and BamHI restriction sites with an In-Fusion HD Cloning Kit (Clontech, CA, USA) (Nekrasov et al. ...
-
bioRxiv - Genetics 2023Quote: ... The full-length cDNAs of SUH1 and BC10 were amplified using the Taq LA DNA polymerase PCR kit from Takara (https://takara.com/) with cDNA-specific primers (Supplementary Table S2) ...
-
bioRxiv - Genomics 2023Quote: ... and 1 ng of embryonic total RNA from rabbits and cattle were reverse transcribed using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara Bio, Japan) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: The pCAG-MDM4 expression vector was established by cloning of MDM4 sequence into a pCAG vector47 containing a multiple cloning site (pCAG-MCS) using In-Fusion® Snap Assembly Starter Bundle kit (#638945; Takara Bio). A single restriction digest was performed on the pCAG-MCS vector using XhoI (Cat ...
-
bioRxiv - Bioengineering 2023Quote: ... cDNA was reverse transcripted from 500ng RNA using PrimeScript™ II 1st strand cDNA Synthesis Kit (Catalog # 6210A TAKARA BIO, Kusatsu, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... RNA from 2 retinae of a mouse was extracted using the NucleoSpin® RNA kits (Takara Bio USA, Inc., San Jose, CA). RNA sample concentration and quality was determined with NanoDrop Oneᶜ Microvolume UV-Vis Spectrophotometers (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: Full length cDNAs were generated and amplified directly from a single cell through the SMART-Seq HT Kit (Takara Cat. No. 634437). Up to 200pg cDNAs were used to generate the dual index Illumina libraries using Nextera XT DNA Library Prep Kit (Illumina Cat No ...
-
bioRxiv - Developmental Biology 2023Quote: ... and libraries were prepared as described previously with the following modifications: Libraries were prepared using the SMART-seq v4 Plus/ultra-low RNA input stranded total RNA-seq kit (Takara Bio Inc.) and sequenced on the NextSeq 1000/2000 (100 cycles ...
-
bioRxiv - Biochemistry 2023Quote: ... Expression plasmids for other His-mCherry or His-GFP fusion proteins were constructed using in-Fusion HD Cloning Kit (Takara Bio, Inc.). All mCherry/GFP fusion proteins were expressed in E ...
-
bioRxiv - Immunology 2023Quote: ... cDNA library was generated from 2 nanograms of total RNA using Smart-Seq V4 Ultra Low Input RNA Kit (Takara catalog#: 634894). 150 picograms of cDNA was used to make sequencing libraries by Nextera XT DNA Sample Preparation Kit (Illumina catalog# ...
-
bioRxiv - Zoology 2024Quote: ... The extracted DNA was sheared to 550 bp target fragments with Covaris M220 and a Illumina library was constructed with a Thruplex DNA-Seq kit (Takara BioRubicon Genomics). Quantification ...
-
bioRxiv - Microbiology 2024Quote: ... Multiplex reverse transcription-PCR amplification of all 8 influenza virus genome segments was performed on RNA samples using PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara 6210) and primers Uni12/Inf1 (5’-GGGGGGAGCAAAAGCAGG-3’) ...
-
bioRxiv - Genetics 2024Quote: ... and 5 μg of the pseudotyping pVSV-G plasmid were co-transfected into HEK293T cells in T75 flasks using CalPhos™ Mammalian Transfection Kit (631312, Takara Bio). The culture medium was replaced 12 hours after transfection with fresh media ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA samples from the patients’s paired tumor tissues and WBCs were used to prepare DNA libraries for DNA sequencing with the ThruPLEX Tag-seq Kit (Takara Bio, USA). The libraries were then pooled and hybridized with pre-designed probes for 95 targeted genes (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... The wild-type AKT1 (NM_001014431.2) was cloned in the pECMV-3×FLAG-N vector using the In-Fusion® HD Cloning Kit (Takara Bio, Cat# 639650). The K20R and K20Q mutant AKT1 plasmids were constructed using the Fast Site-Directed Mutagenesis Kit (TIANGEN ...
-
bioRxiv - Molecular Biology 2024Quote: ... Final NGS libraries were generated using 2ng of the purified 1st PCR product using the dual-indexing Illumina-compatible DNA HT Dual Index kit (Takara #R4000660,R400661). 2nd PCR products were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2024Quote: ... a sequencing library was made using 1 ng of sheared cDNA using Low Input Library Prep Kit v2 (Takara Bio Inc, USA). DNA unique Dual index kit was used to combine libraries for sequencing (Takara Bio Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification of the fragments and their subsequent ligation was performed using the In-Fusion cloning kit and online tools (BD Clontech, Takara Bio, USA), or they were synthesized by GenScript (Piscataway ...
-
bioRxiv - Cancer Biology 2024Quote: ... CASP3 open reading frame and BioID2 either in N-terminus or in C-terminus of CASP3 were inserted into a pcDNA3 vector using the In-Fusion® HD Cloning kit (Takara, 639649) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR product was cloned into XhoI- and SalI-digested sites of pBluescript SK plasmid using an In-Fusion HD Cloning Kit (Takara Bio Inc.). Afterward ...
-
bioRxiv - Neuroscience 2024Quote: The samples were rRNA depleted and prepared for sequencing using SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio, France). In brief ...
-
bioRxiv - Immunology 2024Quote: ... Complementary oligonucleotides with overhangs were annealed and cloned into the BbsI-digested U6b vector using a DNA ligation kit (Takara Bio, 6023). Sense strand:TTCGGAAGTGCCAATCATCACCTC ...
-
bioRxiv - Molecular Biology 2024Quote: Strand-specific RNA-seq was performed on parental and ibrutinib-resistant Rec-1 cells using SMARTer Stranded Total RNA Sample Prep Kit (Takara, cat# 634873) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: The purified product in ICDS method and captured beads in upgraded ICDS method were ready for Illumina library preparation with SMART ChIp-seq kit (Takara, Catalog # 634865) by following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: The purified product and captured beads in upgraded ICDS method were subjected to Illumina library preparation with SMART ChIp-seq kit (Takara, Catalog # 634865) by following the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The adjusted samples were subjected to real-time RT-PCR using the One Step SYBR RT-PCR Kit (Takara Corporation, Tokyo, Japan) and the PIKO REAL 96 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... The rbp3 gene (slr0193) was amplified and ligated into vector pGEX-6P-1 using the In-Fusion Cloning kit (TaKaRa, Shiga, Japan) and the PCR primers pGEX-6P-1_inv-f/-r and Rbp3_iVEC-f/-r (SI Appendix ...
-
bioRxiv - Neuroscience 2024Quote: ... All expression plasmids were validated by Sanger DNA sequencing (Azenta Life Sciences) and prepared using Nucleobind Xtra Midi Endotoxin-free prep kits (Takara Cat # 740420.5), following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2024Quote: ... Constructs that express wrmScarlet-tagged V-ATPase components with gfp::unc-54 3’ UTR were generated using the In-Fusion Advantage PCR cloning kit (Clontech, Cat. #639621). The primers were listed in Extended Data Table 3.
-
bioRxiv - Developmental Biology 2021Quote: Full length human COG4 was cloned into pCS2+ vector from plasmid hCOG4-siR-3myc in AAZ6 (Gift from Professor Vladimir V. Lupashin) using In-Fusion® HD Cloning Kit (TaKaRa Bio, 638909) with primers 5’-ATGGGAACCAAGATGGCGGA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: TdT-mediated dUTP nick end labeling (TUNEL) staining was carried out with In Situ Apoptosis Detection Kit (MK500, Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: TdT-mediated dUTP nick end labeling (TUNEL) staining was carried out with In Situ Apoptosis Detection Kit (MK500, Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: ... Purified RNA served as input for the cDNA library preparation with SMART-Seq v.4 Ultra Low Input RNA kit (Takara Bio, Kusatsu, Japan) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... 100 μL cell culture supernatant was harvested for viral RNA extraction using the MINIBEST Viral RNA/DNA Extraction Kit (Takara, Cat no. 9766). RNA was eluted in 30 μL RNase-free water ...
-
bioRxiv - Genomics 2020Quote: ... All of the precipitated RNA was converted into a sequencing library using SMARTer® smRNA-Seq Kit for Illumina (Thermo Fisher/Takara 635032). The kit protocol was used with the following specifics ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was subjected to rRNA depletion using a modified Ribozero method and library preparation using Clontech SMARTer Stranded RNA-Seq Kits (Takara Bio, Shiga, Japan). Sequencing was performed on the Illumina HiSeq2500 100bp PE Rapid run (Ramaciotti Centre for Genomics ...
-
bioRxiv - Genomics 2020Quote: Round 1 PCR amplicons were collected from the ICELL8 chip using the SMARTer ICELL8 Collection Kit: (Collection Fixture, Collection Tube and Collection Film) into a collection and storage tube as per manufacturer’s instructions (Takara Bio USA, CA, USA). 50% of the extracted library was purified twice using a 1X proportion of AMPure XP beads (Beckman Coulter ...