Labshake search
Citations for Takara Bio :
4951 - 5000 of 5321 citations for Human Lysine K Specific Demethylase 1A KDM1A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA prepared from adult mouse livers was reverse-transcribed using a PrimeScript II first-strand cDNA Synthesis Kit (Takara, Shiga, Japan) with a random hexamer primer ...
-
bioRxiv - Molecular Biology 2024Quote: The full length BRD4 DNA fragment was amplified by PCR from pcDNA4-TO-HA-BRD4FL (Addgene plasmid #31351)61 incorporated into linearized FM5 lentiviral vectors containing standardized linkers (generously provided by David Sanders) using the In-Fusion HD cloning kit (Takara Bio, 638910). BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Genetics 2024Quote: ... GFP-fused Actb WT and S348L in pcDNA3-GFP were amplified using KOD One (TOYOBO, Osaka, Japan) and cloned into pCSf107mT[31] using the In-Fusion HD Cloning Kit (Takara, Shiga, Japan) resulting in pCSf107mT-GFP-Actb WT and S348L ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA with mutations or deletion were constructed by site-directed mutagenesis using PrimeSTAR® HS DNA Polymerase mutagenesis kit (Takara Bio, Japan) following to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were analysed by gel electrophoresis and positive products were purified using the NucleoSpin Gel and PCR clean up kit (Clontech, Takara Bio) before being sent for sequencing by Eurofins Genomics (Germany) ...
-
bioRxiv - Genomics 2024Quote: ... and one microgram of the DNase-treated RNA was used for cDNA synthesis using PrimeScript RT reagent kit (Takara Bio, CA, USA). The expression analysis was performed using TB green Premix Ex Taq II (Takara Bio ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were generated and sequencing was performed by the NY Genome Technology Center with a low input SMART-Seq HT with Nxt HT kit (Clontech Laboratories, 634947) and SP100 cycle flow cell ...
-
bioRxiv - Genomics 2024Quote: We applied three distinct cDNA library enrichment protocols for the RNA sample extracted from the same mice individual: i) standard PacBio Clontech SMARTer PCR cDNA Synthesis kit (Clontech Laboratories, Inc.); ii ...
-
bioRxiv - Cancer Biology 2024Quote: ... MYCN 5′ DEL and 3′ DEL deletion mutants were generated by restriction-free cloning using plasmid PCR amplification and overhang ligation using the In-Fusion Cloning Kit (Takara Bio 638910) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were cloned into a PCR linearized pEcgRNA-guide plasmid to make the pEcgRNA-guide-RT plasmid using In-fusion® HD-cloning kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: The q-PCR standards were synthesized by cloning target genes into Escherichia coli DH5a using a PMD18-T vector Cloning Kit (TaKaRa Biotechnology, China). Vector concentrations were measured using NanoDrop ...
-
bioRxiv - Pathology 2024Quote: First strand cDNA was generated from 1 μg of total RNA using the Prime Script RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). Real-time PCR was performed by using an SYBR Green PCR Master Mix (TaKaRa ...
-
bioRxiv - Developmental Biology 2023Quote: ... and libraries were prepared as described previously with the following modifications: Libraries were prepared using the SMART-seq v4 Plus/ultra-low RNA input stranded total RNA-seq kit (Takara Bio Inc.) and sequenced on the NextSeq 1000/2000 (100 cycles ...
-
bioRxiv - Immunology 2023Quote: Full length cDNAs were generated and amplified directly from a single cell through the SMART-Seq HT Kit (Takara Cat. No. 634437). Up to 200pg cDNAs were used to generate the dual index Illumina libraries using Nextera XT DNA Library Prep Kit (Illumina Cat No ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg RNA was subsequently converted to cDNA using random hexamer primer using PrimeScript™ 1st strand cDNA Synthesis Kit (Takara Bio) in accordance with manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Neurons were transfected with GCaMP6 or NEMO-encoding plasmids at 7 to 9 days after plating using a calcium phosphate transfection kit (Takara Bio Inc).
-
bioRxiv - Cell Biology 2023Quote: ... A total of 1-2 μg RNA was reverse transcribed with random hexamers using PrimeScript 1st strand cDNA synthesis kit (Takara Bio, Japan) per the manufacturer’s protocol on Verti 96 well thermocycler (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Microbiology 2023Quote: ... the two fragments were introduced into a pHSG397 derivative carrying tesB and scdL1 using the In-Fusion HD Cloning Kit (TaKaRa Bio, Japan). This yielded the pHSGScdL2NY-Kmr plasmid carrying tesB ...
-
bioRxiv - Cell Biology 2023Quote: ... Individual master mixes for each gene of interest were prepared using the TB Green® Premix Ex Taq II (TLi RNaseH Plus) reagent kit (RR820A, Takara Bio) and primer sets ordered from Sigma-Aldrich (Supplementary Table 2) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The amplified fragments required to generate the chimeric receptor were combined with a linearized pCS2+ backbone and annealed using an In-Fusion kit (Takara Bio, 638947). The resulting plasmids were transformed into Top10 chemically competent cells ...
-
bioRxiv - Biochemistry 2023Quote: ... 1,5 µg of plasmid DNA and 1,5 µg pOG44 (encoding the Flp recombinase) were mixed and transfected using CalPhos Mammalian Transfection Kit (Clontech®/Takara, #631312). The transfection medium was replaced by complete DMEM after 24 h ...
-
bioRxiv - Immunology 2023Quote: ... Genomic DNA samples from the patients’s paired tumor tissues and WBCs were used to prepare DNA libraries for DNA sequencing with the ThruPLEX Tag-seq Kit (Takara Bio, USA). The libraries were then pooled and hybridized with pre-designed probes for 95 targeted genes (Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a modified pCaSpeR4 vector containing the αTub84B promoter (Marois et al., 2006) using In-Fusion cloning kit (Takara Bio, Japan). Forward primer sequence was 5’-CTAGAGGATCCCCGGGTACCATGGTGAGCAAGGGCGAG-3’ and reverse primer sequence was 5’-TCGAGGGGGGGCCCGGTACCTTAATTGTAAGTAATACTAGATCCAGGGTATAAAGTT GTTC-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of total RNA was used to make cDNA libraries using prime script RT reagent kit gDNA eraser (Takara Bio Inc.) according to the kit’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... The DNA product was purified from the gel slice using the PCR cleanup and gel extraction kits (740609.50, Takara Bio, Kusatsu, Shiga). The purified DNA was cleaned using AMPure XP (A63881 ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... The C-terminus of Rtl9 was fused to a 4x GGS linker (ggaggatcaggaggatcaggaggatcaggaggatca)-attached mCherry by means of a cloning enzyme (In-Fusion® HD Cloning Kit, Takara Bio). The purified targeting vector was assessed for its quality by Sanger sequencing and injected into mouse pronuclei at the final concentration of 10 ng/μl ...
-
bioRxiv - Evolutionary Biology 2023Quote: The 3’UTR sequence of CcTRPM gene was amplified by the 3’-Full RACE Core Set with PrimeScriptTM RTase kit (Cat# 6106, Takara, Kyoto, Japan). miRNAs for CcTRPM were predicted by a service provider LC science with two software programs of miRanda (http://www.microrna.org ...
-
bioRxiv - Cell Biology 2023Quote: The cDNA of sorted tdTomato positive hair cells was synthesized using PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time, RR047A, Takara Bio). Synthesized cDNA was subsequently mixed with qPCR primers and TB Green Premix Ex Taq (Tli RNase H Plus ...
-
bioRxiv - Biochemistry 2023Quote: The DNA sequences corresponding to M.EcoGII and SUPREM were inserted into the pCDNA3.1-eGFP-GSx3 plasmid using the In-Fusion cloning kit (Takara Bio Inc., Shiga, Japan), resulting in a sequence encoding eGFP with a flexible linker sequence (GGGGS)3 linked to the N-terminus of the methyltransferase.
-
bioRxiv - Molecular Biology 2023Quote: ... Accurate quantification of mRNA levels was meticulously conducted by employing the GAPDH reference gene and utilizing the cutting-edge SYBR Green kit (Takara, Kyoto, Japan) on the state-of-the-art Real-time PCR Detection System manufactured by Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... levels were measured by a qRT-PCR assay using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (TaKaRa, Cat# RR096A). The PCR protocol was 42°C for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were cultured again overnight and subjected to the quantification of mRNA by qRT-PCR using the CellAmp Direct RNA Prep Kit for RT-PCR (Real Time) (3732, Takara Bio Inc.), One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR fragment was subcloned into the KpnI-NotI site of the pCAGGS vector20 using In-Fusion HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the PCR products were subcloned into EcoRV site of pBluescript SK- vector using In-Fusion® HD Cloning Kit (TaKaRa Bio, Japan) and sequenced with the M13 forward primer (5’-GTAAAACGACGGCCAG-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated DNA was amplified by PCR using Hot Start TaKaRa LA Taq kit to yield a 10-Kb product (Takara Biotechnology, #RR042A). Primers utilized were the following ...
-
bioRxiv - Biophysics 2023Quote: Retroviral constructs encoding HA3-CXCR4 wild-type or designed variants were generated using the In-Fusion HD Cloning Kit (Takara, ref: 638933). Sequences of interest from the expression constructs mentioned above were amplified by high-fidelity PCR (CloneAmp HiFi PCR Premix ...
-
bioRxiv - Plant Biology 2023Quote: ... The expression of marker genes was detected by qRT-PCR using the One-step TB Green PrimeScriptTM RT-PCR kit II (Takara, Osaka, Japan). All genes were normalized against the level of an actin reference gene (Foo et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR fragment was subcloned into the KpnI-NotI site of the pCAGGS vector10 using In-Fusion HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragmented RNA was used to produce barcoded cDNA sequencing libraries using the SMARTer® Universal Low Input RNA Kit (Takara, 634938). Short-read libraries were sequenced on Illumina NovaSeq S4 (paired-end 2×150) ...
-
Mice generated with induced pluripotent stem cells derived from mucosal-associated invariant T cellsbioRxiv - Immunology 2023Quote: ... and resultant RNAs (10 ng per sample) were subjected to cDNA library construction (SMARTer Mouse TCR a/b profiling kit, Takara Bio, Japan). The next generation sequencing was performed with MiSeq (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were subcloned into pcDNA5 FRT/TO HA FLAG Hu Jaw1 or pcDNA5 FRT/TO Hu Jaw1 (digested with HpaI/XhoI) using an In-Fusion HD Cloning Kit (#Z9648N; TaKaRa, Kusatsu, Japan), resulting in pcDNA5 FRT/TO HA FLAG Hu Jaw1 opsin ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were subcloned into the pcDNA5 FRT/TO HA FLAG Ms Jaw1 (digested with HpaI/SphI) by double-insert cloning using an In-Fusion HD Cloning Kit (#Z9648N; TaKaRa, Kusatsu, Japan), resulting in pcDNA5 FRT/TO HA FLAG Ms Jaw1 504–508A ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were subcloned into the pcDNA5 FRT/TO HA FLAG Ms Jaw1 (digested with HpaI/BamHI) using an In-Fusion HD Cloning Kit (#Z9648N; TaKaRa, Kusatsu, Japan). Similarly ...
-
bioRxiv - Cell Biology 2022Quote: ... and the DNA fragments were ligated to the pcDNA5 FRT/TO HA FLAG vector (digested with the same enzymes) using a DNA Ligation Kit (#6023; TaKaRa, Kusatsu, Japan), resulting in pcDNA5 FRT/TO HA FLAG Hu sec11a and pcDNA5 FRT/TO HA FLAG Hu sec11c ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were subcloned into the pcDNA5 FRT/TO HA FLAG Ms Jaw1 (digested with AfeI/BamHI) using an In-Fusion HD Cloning Kit (#Z9648N; TaKaRa, Kusatsu, Japan) to swap the luminal region of Jaw1 to that of KASH proteins ...
-
bioRxiv - Cell Biology 2022Quote: ... and the DNA fragments were ligated into the pcDNA5 FRT/TO HA FLAG vector (digested with same enzymes) using a DNA Ligation Kit (#6023; TaKaRa, Kusatsu, Japan), resulting in pcDNA5 FRT/TO HA FLAG Ms Jaw1 PA and pcDNA5 FRT/TO HA FLAG Ms Jaw1 NIDR PA ...
-
bioRxiv - Cell Biology 2022Quote: ... The pcDNA5 FRT/TO HA FLAG Hu AASS was then digested with BamHI/ApaI and the DNA fragment was ligated into the pcDNA5 FRT/TO vector using a DNA Ligation Kit (#6023; TaKaRa, Kusatsu, Japan), resulting in pcDNA5 FRT/TO Hu AASS ...
-
bioRxiv - Immunology 2023Quote: ... 110 ng of RNA were retrotranscribed in a final volume of 10 μL using the PrimeScript RT reagent Kit (Takara, Kusatsu, Japan) with a combination of oligo-d(T ...