Labshake search
Citations for Lonza :
301 - 350 of 377 citations for Mouse MYCN shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... cells were washed 1x in RT PBS and transfected with ∼15μg of DNA plasmid using Amaxa nucleofector 2b (Lonza, program O-005). After transfection ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... plasmids pSpCas9n(BB)-ZEB2-Guide-A &-B (0.5 µg of each plasmid) were electroporated into 1×106 H9 cells using the Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012). Following electroporation ...
-
bioRxiv - Biochemistry 2021Quote: ... 105 cells were mixed with a plasmid vector (AsCas12a, n-SpCas9 (D10A, H840A)) and 20 μl of electroporation buffer (Lonza, V4XC-2032) and were nucleofected according to the manufacturer’s instructions (program ...
-
bioRxiv - Immunology 2021Quote: ... gRNA_pX335 plasmids were transfected into EL4 cells by nucleofection using an Amaxa nucleofector and the Cell Line Nucleofector Kit L (Lonza, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 2 million L1.2 cells were transfected with 2 µg of plasmid using the SG Cell Line transfection kit and a 4D-Nucleofector X (both from Lonza, Walkersville, MD) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 1 × 106 BLaER1 cells were transfected with 2 μg plasmid DNA using the Human B Cell Nucleofector Kit and Nucleofector I device (program U-15; both Lonza, Basel, Schweiz). On day 2 post transfection ...
-
bioRxiv - Genetics 2020Quote: ... PFFs were co-electroporated with a circular transposase plasmid pCMV-hyPBase and a circular mPSP-PXAT plasmid using the program A-033 on the Nucleofector 2b Device (Amaxa Biosystems/Lonza, Cologne, Germany). After cell attachment ...
-
bioRxiv - Neuroscience 2020Quote: ... Single iPSCs were then nucleofected with the pX459v2 plasmid coding for the Cas9 protein and the sgRNA using P3 primary Cell 4D nucleofector kit (Lonza, V4XP-302). After nucleofection cells were plated on a 6-well plate in E8 flex medium supplemented with RevitaCell ...
-
bioRxiv - Immunology 2022Quote: 1 × 105 HLFs were mixed with 2 μg of 100 μg/ml of the above expression plasmids in 100 μl PBS (GE Lifesciences, Marlborough, MA) and were transfected by electroporation using a 4D-Nucleofector System (Lonza, Walkersville, MD) following the manufacturer’s protocol CZ-167 ...
-
bioRxiv - Systems Biology 2022Quote: ... The PGK reporter cell line was generated by electroporation of K562 cells with 0.5 ug each of plasmids encoding the AAVS1 TALENs and 1 ug of donor reporter plasmid using program T-016 on the Nucleofector 2b (Lonza, AAB-1001). Cells were treated with 0.5 ug/mL puromycin for one week to enrich for successful integrants ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells generated by transfection with pcDNA3 plasmid containing wild-type BRCA1 (27) were both grown in 50% RPMI-1640 and 50% Mammary Epithelial Growth Medium (Lonza, Basel, Switzerland). Medium for UWB+ B1 cells was supplemented with 200 μg/ ml G418 S (Merck ...
-
bioRxiv - Immunology 2023Quote: ... Then sporozoites were resuspended in transfection buffer supplemented with 100 μg DNA (comprising 50 μg of Cas9/gRNA plasmid and 50 μg of repair template) and electroporated using an Amaxa 4D nucleofector (Lonza, Basel, Switzerland). Parasites carrying a stable transgene were selected using paromomycin added to the drinking water of infected mice ...
-
bioRxiv - Molecular Biology 2023Quote: Induced pluripotent stem cells were transfected with a total of 5 μg target Cas9/gRNA plasmids with or without 1 μg repair templates using Human Stem Cell Nucleofector Kit (LONZA, Basel, Switzerland) and Nucleofector 2b device (LONZA ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1.5 x 106 cells were transfected with 1 µg DNA (500 ng Cas9 plasmid and 500 ng linearized donor plasmid) by nucleofection (pulse code CA137) using P3 Primary Cell 4D-Nucleofector X kit (Lonza, V4XP-3024) in a 4D-Nucleofector (Lonza ...
-
bioRxiv - Neuroscience 2024Quote: ... The transfection of chromaffin cells with the plasmids described above was performed by electroporation in an Amaxa Nucleofector 4D (Lonza, Cologne, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... 5 million parasites were electroporated with 5-10ug of digested plasmid with an AMAXA Nucleofector II using X-001 in Human T-cell Nucleofector Solution (Lonza VPA-1002).
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: Mouse embryonic fibroblasts (MEFs) cells were grown in Dulbecco’s modified Eagle’s medium DMEM (12-614F, Lonza), supplemented with 5% fetal bovine serum and non-essential amino acids at 37°C and 5% CO2.
-
bioRxiv - Molecular Biology 2021Quote: Xist knockdown was performed following manufacturer’s instructions for the Mouse Neural Stem Cell Nucleofector Kit (Lonza). 3-5×106 NSCs were collected and resuspended in 70 μL Nucleofector solution ...
-
bioRxiv - Immunology 2019Quote: ... cells rested overnight in complete medium (human cells) or X-Vivo 15™ (mouse cells) (Lonza) were activated with IL-2 (100U/ml ...
-
bioRxiv - Genetics 2021Quote: ... Transfection was carried out by electroporation using Mouse Embryonic Stem Cell Nucleofector™ Kit from Lonza. After 2 days of transfection GFP expressing cells were FACS sorted and sparsely seeded for clonal expansion on 15cm plate ...
-
bioRxiv - Genomics 2021Quote: ... using a Nucleofector™ 2b device and the Mouse ES Cell Nucleofector Kit (Lonza, VAPH-1001) according to the manufacturer’s instructions and plated into two 10 cm dishes ...
-
bioRxiv - Neuroscience 2020Quote: ... two pairs of sgRNA vectors and Cas9 nickase plasmid were transduced into the AD hPSCs by using Human Stem Cell Nucleofector® Kit 1 (Lonza VPH-5012). Three days after electroporation ...
-
bioRxiv - Cancer Biology 2022Quote: ... activated T cells were subjected to nucleofection with a minicircle CAR donor construct and a Quantum PBase™ plasmid (i.e. qPB) using a Nucleofector™ 2b or 4D Device (Lonza, Morrisville, NC) in combination with either the Amaxa® Human T Cell Nucleofector® Kit (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: Electroporation of multiplex CRISPR-Cas9 pX330 plasmids into normal bronchial epithelial cells was achieved using the P3 Primary Cell 4D-Nucleofector® X Kit L (Lonza, V4XP-3024) and 4D-Nucleofector™ X Unit (Lonza) ...
-
bioRxiv - Neuroscience 2020Quote: The dissociated sensory neuron pellet was resuspended with 98 µL electroporation buffer (Mouse neuron nucleofector kit, Lonza) mixed with RNA oligos (0.2 nmol per transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Smarca4f/f mouse lines) or 20,000 AALE cells were plated on a 0.35% low melting agarose (Lonza) placed over a 0.7% agarose layer in a 6-well plate ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nucleofection experiments were performed following the manufactures’ protocol for mouse embryonic fibroblasts (Amaxa™ Nucleofector™, Lonza). To induce iFoxn1 expression ...
-
bioRxiv - Biochemistry 2022Quote: ... electroporation was carried out following the instructions of the Mouse Embryonic Stem Cell Nucleofector Kit from Lonza. After 2 days recovery ...
-
bioRxiv - Immunology 2023Quote: ... cells were transfected with pcDNA3.1 encoding full-length mouse PD-1 or its mutant using nucleofection (Lonza). Transfected cells were sorted for uniform PD-1 staining and culture in medium with 0.4 cells and reporter Jurkat cells stably expressing WT or MT chimeric PD-1 (mhPD-1 ...
-
bioRxiv - Microbiology 2021Quote: ... electroporated with 10 μg of linearised plasmid DNA or PCR product using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (Lonza, Switzerland, program X-001).
-
bioRxiv - Cancer Biology 2019Quote: ... and 3-4 hours later were transfected with 2 μg of pBabe KRAS WT and pBabe KRAS G12D or pBabe KRAS Q61H plasmid DNA by electroporation using the Amaxa® Human T Cell Nucleofector® Kit (Lonza, Basel, Switzerland) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: A control plasmid (GFP) or GFP-CHMP4B were overexpressed in WI-38 cells by 4D-Nucleofector (Lonza; SE cell line solution; program EO-114) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... LUHMES cells were electroporated and transfected with 2 μg of plasmid using the Amaxa™ Basic Primary Neurons Nucleofector™ Kit and protocol (Lonza, cat. # VPI-1003). Transfected cells were selected by flow-sorting for DAPI negative ...
-
bioRxiv - Molecular Biology 2021Quote: Human and mouse fibroblasts were cultured at 37°C and 5% CO2 in Dulbecco’s modified Eagle’s medium (Lonza) with high glucose supplemented with 10% foetal bovine serum ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 × 106 trypsinized cells were resuspended in 93.5 µl solution (mouse ES cell nucleofector kit, VPH-1001, Lonza). The solution includes 2 µg of each CRISPR/Cas9 vector (4 µg total ...
-
bioRxiv - Developmental Biology 2022Quote: ... and pre-seeded with low density (8,000 cells/cm2) irradiated DR4 mouse embryonic fibroblast (MEF) feeder cells (Lonza) (Matrigel-MEF) ...
-
bioRxiv - Cell Biology 2020Quote: ... Tln1flox/flox (control) and Tln1flox/flox Tln2−/− mouse kidney fibroblasts36 were cultured in DMEM–F12 (12-719, Lonza) with 10% FBS and 100 U/ml penicillin–streptomycin at 37°C ...
-
bioRxiv - Immunology 2023Quote: Electroporation was performed to introduce siRNA into BMDCs using a mouse dendritic cell nucleofector kit (Lonza, Basel, Switzerland) and a Nucleofector 2b (Lonza) ...
-
bioRxiv - Cancer Biology 2019Quote: ... NSCs were harvested with Accutase and 2-3×106 cells were resuspended in 100µl mouse neural stem cell nucleofector buffer (Lonza) with 2µg plasmid DNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... pPBCAG-hph and a PiggyBac Transposase vector using the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001). Transfected cells were selected with 200 μg/ml hygromycin B Gold (Ibian tech. ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5×106 EL16.7 TST ESCs were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001) using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... The siRNA transfections for primary BMDMs and pancreatic fibroblasts were performed using the Mouse Macrophage Nucleofector™ Kit (Lonza) and Nucleofector™ 2b Device (Lonza ...
-
bioRxiv - Biochemistry 2021Quote: ... or ds-UM DNA oligos (IDT) (Table S4) were nucleofected into mouse ES cells using an Amaxa nucleofector (Lonza) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... For each nucleofection 3 x 106 cells were resuspended in 80 μl of mouse ES cell nucleofection solution (Lonza). Equimolar (0.32 nmol ...
-
bioRxiv - Molecular Biology 2019Quote: ... and wild-type J1 male mouse embryonic stem cells were grown on 0.1% gelatin-coated dishes in DMEM (Lonza) complemented with 10% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... On day 7 cells were nucleofected using the Amaxa Mouse T Cell Nucleofector Kit (Lonza, Cat no. VVPA-1006) per the manufacturer’s instructions with 5x106 cells and 1.5µg plasmid DNA per cuvette ...
-
bioRxiv - Cell Biology 2021Quote: ... MEFs were immortalized with pBabe-SV40Tag by electroporation using the Amaxa Mouse/Rat Hepatocyte Nucleofector Kit (Lonza, VPL-1004). Immortalized MEF lines were genotyped ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse CCL206 lung fibroblasts (CCL-206; ATCC, Wesel, Germany, RRID: CVCL_0437) were cultured in DMEM (Lonza, Basel, Switzerland, #42430):Ham’s F12 (Gibco ...