Labshake search
Citations for Lonza :
351 - 400 of 1498 citations for 4 5 5 5 Tetrafluoro 4 trifluoromethoxy pentan 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... Hydrogels were fabricated using a solution consisting of lyophilized GelMA (5 wt%) dissolved at 37°C in phosphate buffered saline (PBS; Lonza 17-516F) and combined with 0.1% w/v lithium acylphosphinate (LAP ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were maintained at 37°C in a humidified incubator containing 95% air and 5% CO2 and routinely tested for mycoplasma contamination with the MycoAlert Assay (Lonza, LT07-418). For experiments requiring manipulation of cystine availability ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 humidity and were tested routinely for mycoplasma using MycoAlert mycoplasma detection kit (Lonza, LT07-318) and appropriate positive control (Lonza ...
-
bioRxiv - Biochemistry 2024Quote: ... All the cells were maintained in a humidified incubator with 5% CO2 at 37 °C and tested negative for mycoplasma by MycoAlert (Lonza, Morristown, NJ). Cells from passage 14-15 (P14-15 ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... All cell lines used in this study were tested mycoplasma free by first culturing the cells for 3-5 days in antibiotic-free media and then subjected to a mycoplasma tested using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, UK).
-
bioRxiv - Cell Biology 2023Quote: ... All cells were cultured at 37 °C and 5% CO2 in a humidified incubator and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Cancer Biology 2023Quote: ... Cells lines were maintained in a humidified 37°C incubator with 5% CO2 and routinely tested for mycoplasma contamination (Lonza #LT07-118).
-
bioRxiv - Genomics 2023Quote: ... All cells were cultured with 5% CO2 at 37°C and verified to be free of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218). Wild type MCF7 cells were a gift from Howard Y ...
-
bioRxiv - Molecular Biology 2023Quote: Induced pluripotent stem cells were transfected with a total of 5 μg target Cas9/gRNA plasmids with or without 1 μg repair templates using Human Stem Cell Nucleofector Kit (LONZA, Basel, Switzerland) and Nucleofector 2b device (LONZA ...
-
bioRxiv - Genomics 2023Quote: ... were washed twice with PBS and resuspended in a solution containing a 4.5:5 mixture of nucleofection buffer (Buffer SE, Lonza Lot #: S-09279) and supplement (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell lines were cultured in a humidified incubator at 37°C and 5% CO2 and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Microbiology 2024Quote: ... All cells were maintained in a humidified incubator with 5% CO2 at 37°C and tested negative for mycoplasma by MycoAlert (Lonza, Morristown, NJ).
-
bioRxiv - Cell Biology 2024Quote: ... Cells were maintained at 37°C and 5% CO2 in 2D monolayer culture and confirmed as Mycoplasma negative (MycoAlert Mycoplasma Detection Kit, Lonza #LT07-701). Cells were maintained in DMEM medium (Corning #10-013-CV ...
-
bioRxiv - Genetics 2024Quote: ... All the cells were grown with 5% CO2 at 37°C and verified mycoplasma-free using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218). The differentiation of WTC11 i3N iPSCs into excitatory neurons was performed using a two-step differentiation protocol ...
-
bioRxiv - Biophysics 2024Quote: ... Cells were mixed with buffer by pipetting the mixture up and down 5 times and electroporated using Lonza electroporator (Lonza 4D-Nucleofactor) using the CM130 pulse program ...
-
bioRxiv - Cell Biology 2020Quote: Electroporation was performed using an Amaxa 4-D device (Lonza) or a Neon Transfection System (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 days after nucleofection with the AMAXA Nucleofector Kit (Lonza), we applied puromycin selection until we observed the appearance of green colonies ...
-
bioRxiv - Developmental Biology 2020Quote: ... embedded in 4% low melting temperature agarose (Lonza, Cat # 50100) and sectioned in a vibratome to produce 300μm-thick coronal slices ...
-
bioRxiv - Neuroscience 2024Quote: ... and mounted in 4% low melting point agarose (50100, Lonza) for sectioning (70 μm ...
-
bioRxiv - Bioengineering 2023Quote: ... Normal human dermal fibroblasts (NHDFs; Lonza; passages 4 to 10) were cultured on dishes in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Cell Biology 2024Quote: Human umbilical vein ECs (HUVECs, passage 4-6, pooled, Lonza) were cultured in EC growth medium-2 (EGM™-2 Bulletkit™ ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were cultured at 37°C and 5% CO2 in DMEM (H3BE12-604F/U1, Lonza Group AG [Cultek S.L.U, Madrid, Spain]) supplemented with 10% tetracycline-free FBS (631106 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Microbiology 2020Quote: ... The final extension step was extended for 5 minutes and product size was confirmed by electrophoresis with a FlashGel™ DNA Kit (Lonza, Basel, Switzerland). PCR products were then purified with the DNA Clean & Concentrator kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells are spun at 1250 x g for 5 minutes and resuspended in 25 µl Lonza SF buffer (Lonza Cat. No. V4SC-2960) if cycloheximide selection will not be used or 200 µl of SF buffer if cycloheximide selection will be used.
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Immunology 2023Quote: ... Cells were cultured at 37°C with 5% CO2 and were regularly tested for mycoplasma contamination using the MycoAlert® PLUS Mycoplasma Detection Kit (Lonza, LT07-703), and authenticated by Microsynth ...
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expanded in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 12.5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 52 years-old; non-CF donor #2: WT-AB0834, male, 71 years-old; non-CF donor #4: CC-2540S-20TL256517, Lonza, female, 48 years-old). After co-incubation with correctors for 24 h in medium (MucilAir™ medium ...
-
bioRxiv - Neuroscience 2022Quote: ... pCE-hOCT3/4 and pCE-mp53DD using the Amaxa Nucleofactor (Lonza). The cells were then cultured in TeSR-E7 medium for 3-4 weeks on Matrigel-coated dishes (Corning ...
-
bioRxiv - Biophysics 2021Quote: ... in passages 4-8 were cultured in EGM2-MV medium (Lonza) at 37°C in a humidified atmosphere of 95% air and 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... in passages 4-8 were cultured in EGM2-MV medium (Lonza) at 37°C in a humidified atmosphere of 95% air and 5% CO2 ...
-
bioRxiv - Microbiology 2022Quote: ... Digested products were then visualised on a 4% NuSieve (Lonza, 50090) agarose gel with SafeView Nucleic Acid Stain.
-
bioRxiv - Bioengineering 2023Quote: ... The brain was then embedded in 4% agarose (SeaPlaque agarose, Lonza) hydrogel ...
-
bioRxiv - Developmental Biology 2024Quote: ... embedded embryos in 4% NuSieve GTG agarose (Lonza, Rockland, ME, USA), and sectioned at 50 µm (acvrl1 ...
-
bioRxiv - Cell Biology 2024Quote: ... in passages 4-8 were cultured in EGM2-MV medium (Lonza).
-
bioRxiv - Immunology 2023Quote: ... embedded in 4% low melting point agarose (GTG-NuSieve Agarose, Lonza) and sectioned into 500 μM slices using a vibratome (VT1000S ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... non-CF#4 (CC-2540S -20TL356517, Lonza, female, 48 years-old). hAEC cells were cultured for several days until reaching 90-95% confluency in complete PneumaCultExPlus medium ...
-
bioRxiv - Cell Biology 2023Quote: ... 1uL electroporation enhancer and 4 uL PBS (Lonza Biosciences, Lexington, MA). Each cell suspension was added to individual wells of an electroporation cuvette (Lonza Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines were cultured at 37°C and 5% CO2 and tested for mycoplasma contamination using a MycoAlert® mycoplasma detection kit (Lonza, cat: LT07-218). Only mycoplasma-negative cells were used.
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 was mixed with 500 pmol (5 μM) of 3xNLS-SpCas9-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3024) up to 25 μl in one tube ...
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 (see sequences of sgRNAs in Table S2) was mixed with 100 pmol (5 μM) of 3xNLS-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3032) up to 5 μl in one tube ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were maintained at 37°C with 5% CO2 and were regularly tested for Mycoplasma contamination using the MycoAlert PLUS kit (Lonza, Cat. No. LT07 −705).
-
bioRxiv - Genomics 2024Quote: ... 300 pmol (15 μM) of sg1617 was mixed with 100 pmol (5 μM) of 3xNLS-SpCas9-HiFi protein and added electroporation buffer (Lonza 4D, cat# V4XP-3032) up to 5 μl in one tube ...