Labshake search
Citations for Lonza :
201 - 250 of 1498 citations for 4 5 5 5 Tetrafluoro 4 trifluoromethoxy pentan 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Cells were harvested by centrifugation at 1,250g for 5 minutes and resuspended in 25 µL SF buffer (Lonza) to a final concentration of 2E6 cells/µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... kept with males and fed with yeast paste (n=5) were dissected in Schneider’s media (Lonza; LZ04-351Q) containing 200 μg/mL insulin (Sigma ...
-
bioRxiv - Genetics 2020Quote: ... 20 µg ssODNs and 4 µg pSpCas9(BB)-2A-GFP construct using Human Stem Cell Nucleofector Kit 2 (Lonza). For the generation of UE-RASGEF1A-int1-KO and PIK3C2B-int10-KO hPSC lines ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Isolated NK cells were activated at 1 x 106 cells mL-1 for 5 days in XVivo15 medium (Lonza) with 5% fetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary XP-C patient fibroblasts XP168LV were cultured at 37°C in an atmosphere of 5% CO2 in Ham’s F10 medium without thymidine (Lonza) supplemented with 20% fetal calf serum and antibiotics.
-
bioRxiv - Cell Biology 2020Quote: ... mouse skeletal myoblasts were grown at 37°C with a 5% CO2 humidified atmosphere in Dulbecco’s Modified Eagle’s Medium with 4.5 g.L−1 Glucose (DMEM; Lonza Bioscience, Bâle, Zwitzerland), supplemented with 10% fetal Bovin Serum (FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... were grown at 37°C (5 % CO2) in supplemented DMEM: Dulbecco’s Modified Eagle’s Medium with 4.5 % glucose (Lonza, Visp, Switzerland) supplemented with 10 % fetal bovine serum (Gibco ...
-
bioRxiv - Genomics 2020Quote: ... and 5×104 cells were resuspended in 20 μL SF electroporation buffer prepared with SF supplement (Lonza, Basel, Switzerland). 3 μL RNP complex solution was mixed with the cells and the cells were nucleofected using program DJ-110 on a 4D-Nucleofector (Lonza ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 × 106 of EGFP-PGCs were resuspended in a total volume of 100 μl Nucleofector Solution V (Lonza, Switzerland) premixed with 10 μg of Cas9 plasmid and the same amount of phiC31 integrase ...
-
bioRxiv - Genetics 2020Quote: ... 5μg vector (in 5μl) transfected into 5 million CD4 T cells in 100μl 1M nucleofection solution67) using a Nucleofector 2b device (Lonza; program V024 for resting T cells and T023 for stimulated T cells) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5×106 EL16.7 TST ESCs were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001) using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: Whole-mount Drosophila ovary samples (approximately 5 flies per experiment) were dissected into Grace’s insect media (Lonza, Walkersville, MD) and fixed for 10 minutes at room temperature in 4% paraformaldehyde in Grace’s insect media ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 μg of DNA was used to transfect the cells using the Amaxa Cell Line Nucleofector kit (Lonza Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Microbiology 2021Quote: ... was adjusted to OD600 of 2.5 (2.2 × 109 bacteria/mL) and the bacteria were then further diluted in serum-free XVIVO-15 medium (Lonza) prior to infection to obtain the respective multiplicity of infection (MOI) ...
-
bioRxiv - Immunology 2021Quote: ... Naive CD4+ T cells were cultured at 5% CO2/37°C in serum-free X-Vivo 15 medium (Lonza).
-
bioRxiv - Microbiology 2021Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Microbiology 2022Quote: ... and the well was gently washed once with 5 mL of phosphate buffered saline (PBS, Lonza, Rockland, ME, USA) to remove un-adherent floating bacteria ...
-
bioRxiv - Microbiology 2022Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Cancer Biology 2024Quote: ... Red blood cell lysis was performed for 5 min at room temperature in ACK lysing buffer (Lonza, #10-548E). For flow cytometry ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Biochemistry 2023Quote: Plasma cholesterol was depleted by treating HEK293 cells with 5 mM MβCD for 30 min in Pro293A-CDM (Lonza); this short period of MβCD treatment was deemed sufficient to removed 50% of endogenous cholesterol from cells (34) ...
-
bioRxiv - Biochemistry 2024Quote: Human HeLa cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP were formed by mixing 5 to 9 μgr base editor protein with 1.5 μgr of sgRNA in 20 μL of P3 buffer (Lonza, Amaxa P3 Primary Cell 4D-Nucleofector Kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were pelleted at 1000 rpm for 5 min and resuspended in 100 μL nucleofector solution (Lonza, #VPB-1002) before adding 2.5 μg of plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... were cultured at 37°C and 5% CO2 in EGMTM Endothelial Cell Growth Medium with BulletKitTM (Lonza CC-3124) and 1x antibiotic-antimycotic (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... Cas9-gRNA ribonucleoproteins were assembled as described previously53 and nucleofected into 5×106 monocytes in 100μL nucleofection buffer (Human Monocyte Nucleofection Kit, Lonza) using a Nucleofector 2b (Lonza ...
-
bioRxiv - Genomics 2023Quote: ... Cells were grown at 37°C and 5% CO2 and passed with Hepes buffered saline solution (Lonza, CC-5024) and 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: Primary human alveolar epithelial cells (HPAECs, CellBiologics) were cultured at 37°C and 5% CO2 with SABM medium (Lonza), SAGM supplements (Lonza) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Biochemistry 2024Quote: Human lung carcinoma A549 cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2024Quote: Primary human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 μM Alt-R Cas9 Electroporation enhancer (IDT) and 4 μM single-strand DNA homology template (Ultramer DNA Oligonucleotide, Lonza). After electroporation ...
-
bioRxiv - Neuroscience 2021Quote: ... a 4% agarose (SeaPlaqueTM GTGTM Agarose, 50111; Lonza) solution was prepared in 0.1M PBS and left at 45°C in a dry bath ...
-
bioRxiv - Bioengineering 2022Quote: ... supplemented with 4 mmol/L L-glutamine (Lonza), 100 IU/ml Penicillin/100 mg/ml Streptomycin (Lonza) ...
-
bioRxiv - Neuroscience 2021Quote: ... containing 4% low melting point agarose (50111, Lonza) which was then allowed to solidify at 4°C for a few minutes ...
-
bioRxiv - Bioengineering 2020Quote: Passage 4 human mesenchymal stem cells (Lonza, Switzerland) were expanded to passage 5 in an incubator set at 37°C and 5% CO2 and fed with low glucose DMEM and glutamine ...
-
bioRxiv - Cancer Biology 2020Quote: ... and embedded in 4% low-melting agarose (Lonza) preheated at 42 °C ...
-
bioRxiv - Genomics 2022Quote: ... 4 million cells were electroporated (Amaxa Nucleofection, Lonza) with 25μg of L1-Cag/FLAG_NLS_ORF-1L plasmid and 15μg of pIC-Cre ...
-
bioRxiv - Microbiology 2023Quote: ... 4 x 104 in 0.4 mL MEM (Lonza), 10% FBS (Corning) ...
-
bioRxiv - Cell Biology 2023Quote: ... or Melanocyte Growth Basal Medium-4 (Lonza, Switzerland) after pigmented cells were dominant.
-
bioRxiv - Cancer Biology 2022Quote: A small fragment (2-4 mm3) of tumor biopsies or surgically resected tumor was cultured in RPMI 1640 plus (Lonza) containing 10% FBS Hyclone (GE Healthcare) ...
-
bioRxiv - Microbiology 2022Quote: ... for 24 h then interleukin-2 (50U/ml) for 4-6 days before nucleofection (as recommended by the manufacturer, Lonza) or infection by HIV-1.
-
bioRxiv - Neuroscience 2021Quote: ... the suspension was centrifuged (215g for 5min at 4°C) and the pellet was resuspended in BMEC-media that comprised of EBM-2 medium (Lonza) supplemented with the following ...
-
bioRxiv - Cell Biology 2024Quote: PC-3 cells (1 × 106 cells) were transfected with 2 μg of mGFP-GPI cDNA using a 4-D nucleofector (LONZA) and cultured in two 150-mm dishes until reaching approximately 100% confluence (2 × 107 cells) ...
-
bioRxiv - Bioengineering 2024Quote: ... The mixture was transferred to a confocal plate and subsequently UV crosslinked at 15 mW/cm2 for 1 minute and cultured for 4 days in EGM-2 media (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 11 mM glucose and 25 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) pH 7.4 (Lonza, Basel, Switzerland). The apical (AP ...
-
bioRxiv - Cancer Biology 2020Quote: ... CHO-S cells were resuspended at a density of 4 mio cells/mL in ProCHO 4 medium (Lonza, #LZ-BE12-029Q) supplemented with 8 mM ultraglutamine (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were maintained at 37°C and 5 % CO2 in a humidified atmosphere and routinely tested to be mycoplasma negative (MycoAlert Mycoplasma Detection Kit, Lonza). Cells were cultured no longer than 15 passages before experimental use.