Labshake search
Citations for Lonza :
451 - 500 of 1498 citations for 4 5 5 5 Tetrafluoro 4 trifluoromethoxy pentan 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 4 μl of the RNP-complex was added and transfected usine program CM150 of the nucleofection device (Lonza). After transfection cells were seeded in StemFlex™ medium (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: Inguinal white adipose tissue from 3-4 WT-C57Bl/6 male mice was collected and placed in Dulbecco’s modified eagle’s medium (DMEM; Lonza) supplemented with 1% Penicillin/Streptomycin (PS ...
-
bioRxiv - Genomics 2020Quote: ... that were then electroporated using a Lonza 4-D Nucleofector with 96-well Shuttle™ add-on (Lonza). Sequences of sgRNA can be found in Supplementary Table 2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... One million cells were electroporated (Nucleofector, Lonza), and after 48h ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were tested for Mycoplasma contamination every 4 - 6 weeks and before each experiment (Mycoalert Mycoplasma Detection kit, Lonza).
-
bioRxiv - Immunology 2022Quote: ... The solution was centrifuged at 400G for 5 minutes at 4°C and the cell pellet was resuspended in 1mL of Hank’s Balanced Salt Solution (HBSS; Lonza) containing 1% BSA (Sigma Aldrich ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: SiRNAs or overexpressing plasmids were transfected into day 4 differentiated BAT1 brown adipocytes using Amaxa Nucleofector II Electroporator (Lonza) with an Amaxa cell line nucleofector kit L according to the manufacturer’s instructions (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... Aliquots of 4 · 105 cells were transferred into individual wells of 16-well or 96-well nucleofection cuvettes (Lonza), combined with 20 µL pre-formed RNP or nucleofector solution (no RNP control) ...
-
bioRxiv - Neuroscience 2020Quote: ... 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG, G-013 program; Lonza) before plating and maintained for 48 h.
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma contamination was conducted every 3-4 weeks using the MycoAlert PLUS mycoplasma detection kit (Lonza).
-
bioRxiv - Immunology 2023Quote: ... 1e6 cells were then mixed with either Cas9 or base editor mRNA (4 - 4.5 µg) and nucleofected with program EO-115 using a 4D Nucleofector (Lonza). Immediately after nucleofection ...
-
bioRxiv - Cell Biology 2024Quote: ... Ligase 4 was transiently complemented into KO cell lines by transfecting 500,000 cells with 100 ng of pmaxGFP (Lonza) and 500 ng of expression plasmid (empty vector ...
-
bioRxiv - Genomics 2024Quote: Transfection– K562-based CRISPR cell lines were nucleofected with 500 ng sgRNA plasmid DNA using 4-D nucleofector X Unit with 16-well nucleocuvette strips according to the manufacturer’s instructions (Lonza). For Casilio-i perturbations ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-sense RNA probe against Gdnf exons was transcribed and hybridized on thick sections derived from P4 kidneys embedded in 4% low melting agarose (NuSieve GTG, Lonza). BM purple was used for colorimetric reaction.
-
bioRxiv - Immunology 2021Quote: ... suspension CHO cells expressing wildtype human CTLA-4 were plated at 1 × 106 cells/well in DPBS (Lonza, Basel, Switzerland) containing 0.5% BSA (MilliporeSigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 μg of linearized plasmid containing wild-type or Ku70 3A cDNA was transfected using Amaxa nucleofector solution V (Lonza) and program T-020 ...
-
bioRxiv - Microbiology 2020Quote: ... The same number of cells (2 x 106 cells) were lysed in 100 µl of 1% CHAPS/PBS and analyzed on 4-20% SDS-PAGE gel (Lonza). The envelope proteins were detected by 2F5 (specific for gp41 ...
-
bioRxiv - Molecular Biology 2020Quote: ... at Day 3-4 of phase I culture were electroporated using P3 Primary Cell 4D NucleofectorTM X Kit (from Lonza) with program DZ100 (Bak et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... Expression of eGFP-Centrin1 was achieved by electroporating 4.106 B lymphoma cells with 4 μg of plasmid using the Amaxa Cell Line Nucleofector Kit R (T-016 program, Lonza). Cells were cultured in CLICK medium for 5 to 16 h before imaging.
-
bioRxiv - Biochemistry 2022Quote: ... and 18-36 μl ribonucleoprotein complexes were added along with 4 μM Alt-R Cas9 electroporation enhancer (IDT) to a nucleofection chamber (Lonza). Cells were electroporated using the nucleofector program EN-138 and gently resuspended in DMEM ...
-
bioRxiv - Biophysics 2022Quote: ... 4-6 µg of DNA was mixed with the resuspended cells and electroporated using the Amaxa cell nucleofector (Lonza Laboratories) program Q-001 ...
-
bioRxiv - Cell Biology 2021Quote: ... or mutant) plasmids (4µg) were introduced to 4×106 dissociated neurons using Amaxa rat nucleofector kit (Lonza Bioscience, VPG-1003). Amaxa-nucleofected neurons plated at 500,000 cells per 35mm poly-D-lysine-coated glass bottom dish (WillCo Wells ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell line authenticity was confirmed by STR genotyping (July 2019) and mycoplasma testing was performed every 4-6 weeks (MycoAlert, Lonza).
-
bioRxiv - Cell Biology 2021Quote: ... was generated by the introduction of a plasmid carrying the EGFP gene under the control of the CAG promoter to EStTA5-4 cells using the Amaxa Mouse ES cells Nucleofector Kit (VPH-1001, Lonza).
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Immunology 2020Quote: ... Cells were mixed with 5 μl of the RNP mixture by gently pipetting and were transferred to pre-cooled (4 °C) 16 well Nucleocuvette Strips (Lonza). Primary human B cells were nucleofected using the EH100 program of Lonza’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cell Biology 2021Quote: ... were isolated from healthy donors (n=3) as described[4] and seeded on 6 cm dishes within BEGM media (Lonza) before transduction with lentivirus (empty vector (Origene ...
-
bioRxiv - Cell Biology 2021Quote: ... Western blots were conducted by running equivalent amounts of protein on 4-20% Tris-Glycine SDS/polyacrylamide gradient gels (Lonza) after reduction with 2-mercaptoethanol and heating to 95°C for 5m ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg of plasmid DNA was introduced to 4×106 neurons using an AMAXA nucleofection kit (VPG-1001, VPG-1003; Lonza). AMAXA-nucleofected cells were plated in 35mm glass bottom imaging dishes ...
-
bioRxiv - Molecular Biology 2023Quote: ... the paired RNPs were combined and nucleofected into 4×105 Raw 264-7 cells suspended in 10 ul of nucleofection buffer (Lonza) using the program DS-136 in a 4D Nucleofector X Unit (Lonza) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Neuroscience 2024Quote: ... Four wells of EBs per line were seeded in a 4-layer cell discs coated with growth factor-reduced matrigel in X-VIVO15 medium (Lonza) supplied with GlutaMAX (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.
-
bioRxiv - Immunology 2021Quote: ... Buffy coat cells were washed three times in 2.5 mM EDTA-PBS at 4°C before dilution and maintenance in RPMI-1640 supplemented with 10% FCS (PAA, AT or Lonza, CH) 2 mM glutamine ...
-
bioRxiv - Genomics 2021Quote: The MPRA libraries were electroporated in 4 to 6 million cells each using the Nucleofector 2b or 4D (Lonza, Basel, Switzerland) with 6 µg of plasmid DNA and program T-030 or Y-001 and DS-132 ...
-
bioRxiv - Physiology 2022Quote: ... 5 million cells were washed with phosphate buffered saline (PBS) and electroporated with 4-6 μg of appropriate plasmid construct using an Amaxa cell nucleofector (Lonza laboratories) and nucleofection reagent (362.88 mM ATP-disodium salt ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were grown under sterile conditions for no longer than 4 weeks after thawing and were frequently tested for Mycoplasma using the MycoAlert® Assay kit (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... DCs derived from progenitor cells were transfected with 4 μg of DNA using the nucleofector kit for primary T cells (Amaxa, Lonza Group) following the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2022Quote: ... One hundred microliters of adenylate kinase detection reagent (Lonza) were added to each well and the content was homogenized by gently pipetting up and down ...
-
bioRxiv - Genomics 2024Quote: Fifteen Asian donors and one European control sample (Lonza 4W-270 ...