Labshake search
Citations for Lonza :
3801 - 3850 of 4910 citations for Rat Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... from healthy donor’s peripheral blood mononuclear cells (PBMCs) and cultured in RPMI (Lonza Bioscience) with 10% FCS ...
-
bioRxiv - Bioengineering 2024Quote: Human aortic endothelial cells (HAECs) were purchased from LONZA (Lonza cat. no. CC-2535) and used at early passages of 2 to 5 in all experiments ...
-
bioRxiv - Bioengineering 2024Quote: CHOK1SV GS-KO® host cells (GS Xceed® Gene Expression System, Lonza, UK), were cultured in suspension in CD-CHO medium (Gibco™ ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were re-plated in Skeletal Muscle Growth Medium-2 (Cat# CC-3245, Lonza) for expansion ...
-
bioRxiv - Immunology 2024Quote: ... HUVEC cells were grown in EGM Plus media supplemented with EGM Plus SingleQuots (Lonza).
-
bioRxiv - Cell Biology 2024Quote: Human umbilical vein endothelial cells (HUVECs) were cultured in EBM-2 (Lonza CC-3156) media supplemented with EGM-2 SingleQuots Supplements (Lonza CC-4176 ...
-
bioRxiv - Cell Biology 2024Quote: Primary human lung microvascular endothelial cells (HMVEC-L) were purchased from Lonza (CC-2527). HMVEC-L were cultured in EGMTM-2MV Microvascular Endothelial Cell Growth Medium-2 BulletKitTM (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: ... LSECs were cultured in endothelial cell basal medium-2 (EBM-2, Lonza, CC-3162). THP-1 cells were cultured in suspension in RPMI 1640 Media (Cytiva ...
-
bioRxiv - Microbiology 2024Quote: ... we counted cells with flow cytometry after staining with 1x Sybr green (Lonza 50513) for 30 minutes in the dark ...
-
bioRxiv - Physiology 2024Quote: ... were obtained from PromoCell and grown in EGM-2MV (microvascular endothelial cell growth medium-2) medium from Lonza Bioscience as previously described (3) ...
-
bioRxiv - Genomics 2024Quote: PBMCs were quickly thawed and placed in pre-warmed xVIVO15 cell culture medium (Lonza) supplemented with 5% heat-inactivated FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... or a FOXO1-targeted siRNA (GAGCGUGCCCUACUUCAAGGA) using the Amaxa(tm) Basic Nucleofector(tm) Kit for Primary Mammalian Fibroblasts (Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... Two million WTC iPSC were nucleofected using an Amaxa nucleofector 2B and the Nucleofector Kit C (both from Lonza), 0.5 µg of each AAVS1 TALEN pair and 1 µg of the donor plasmid (see Figure S4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cellular ATP levels were detected 20 h after glutamate exposure using the ViaLight™ Plus-Kit (Lonza, Verviers, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... Endotoxin concentrations were measured in all protein samples using the Limulus Amebocyte Lysate Kit – QCL-1000 (Lonza, Basel, Switzerland). The rMIC1 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2×105 dissociated neurons were transfected with Lonza Nucleofector using the Basic Neuron SCN Nucleofector kit (Lonza, Basel, Switzerland). Transfected neurons were incubated for indicating days and processed for subsequent analyses.
-
bioRxiv - Cancer Biology 2021Quote: ... The siRNA transfections for primary BMDMs and pancreatic fibroblasts were performed using the Mouse Macrophage Nucleofector™ Kit (Lonza) and Nucleofector™ 2b Device (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... berghei ANKA using the parasite nucleofector II kit and the Nucleofector II device with the U-033 program (Lonza). Transfected parasites were injected intravenously into 5 - 7 weeks old female ddY mice ...
-
bioRxiv - Microbiology 2021Quote: ... Relative adenylate kinase levels were measured on 40μL of supernatants via the ToxiLightTM Non-Destructive Cytotoxicity BioAssay Kit (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 300 pmol of HDR oligonucleotide was electroporated into one million HEK293 Flp-In T-Rex cells along with 2.5 μg each of pSpCas9(BB)-2A-Puro and BiP gRNA plasmid (Amaxa kit R, program A-24; Lonza). Immediately after electroporation ...
-
bioRxiv - Genetics 2019Quote: DNA was delivered to A17iCre mESCs (23, 32) by nucleofection (Amaxa Nucleofector 2b, mESC Nucleofector Kit, Lonza, VVPH-1001). mESCs were treated with 1 μg/mL doxycycline for 18 hours to induce Cre recombinase ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1×106 EBdCas9 cells were transfected with the above RNP complex and 100μM of ssDNA (HDR)(Sup Table 8) using AMAXA electroporation kit (LONZA) and plated in TeSR media (supplemented with 5μM ROCKi) ...
-
bioRxiv - Developmental Biology 2020Quote: ... HLECs were grown on culture dishes or glass slide coated with 0.2% gelatin and were maintained in EGM-2 EC Growth Medium-2 Bullet Kit (Lonza). All experiments were conducted using cells until passage (P ...
-
bioRxiv - Physiology 2021Quote: Bacterial endotoxin measurement in portal serum samples was performed using the Lonza Pyrogent turbidometric LAL assay kit (Lonza, N383) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 50 μg/mL Streptomycin and 50 μM β-mercaptoethanol) and regularly tested for mycoplasma (MycoAlert Mycoplasma Detection kit, Lonza). The B16-F1-mCherry and B16-F1-Azurite cell lines were generated by lentiviral transduction ...
-
bioRxiv - Genetics 2019Quote: ... Primary VSMCs were cultured on gelatinized dishes in SmBM medium supplemented with the SmGM-2 kit (CC-3182, Lonza). Unless otherwise specified ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1x106 A2lox mESCs (WT and Bra-/-) were transfected with 2.5 μg of linearized vector using the Nucleofector ESC kit (Lonza) and G418 selected (350 μg/ml ...
-
bioRxiv - Systems Biology 2022Quote: ... Electroporation mix was performed using the Lonza Amaxa SE Nucleofection 4D kit in the 100μl format with the 4D-NucleofectorTM X Unit (Lonza) machine ...
-
bioRxiv - Molecular Biology 2024Quote: ... we modified the protocol and compared site-by-site the transfection efficiency of the Basic Parasite Nucleofector Kit (Lonza) and Tb-BSF protocol (Schumann Burkard et al. ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... All generated knockout clones were tested negative for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (Lonza, Cat#LT07-318).
-
bioRxiv - Cancer Biology 2024Quote: ... Routine examinations for mycoplasma contamination were conducted using a mycoplasma detection kit (MycoAlert™, Lonza, cat. no. LT07-318). The cells were passaged no more than 8-10 times (twice a week ...
-
bioRxiv - Neuroscience 2022Quote: ... and sgRNAs against LRRK2 (crRNAs ordered from IDT) were introduced into iPSCs via nucleofection (Lonza P3 kit # V4XP-3032) as described before(75) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 8×107 promastigotes were transfected with 1 µg (≈ 1,68.1011 molecules) of the linearized barcoding library using the Basic Parasite Nucleofector™ kit 1 (Lonza) with the U-033 program ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma contamination was conducted every 3-4 weeks using the MycoAlert PLUS mycoplasma detection kit (Lonza).
-
bioRxiv - Developmental Biology 2024Quote: ... Mycoplasma testing was carried out by DAPI staining of fixed cultures and using the mycoalert mycoplasma detection kit (Lonza). We confirm that the cell lines used in this study were free of mycoplasma and aerobic bacteria and fungi.
-
bioRxiv - Cell Biology 2020Quote: ... Modified MTEC culture media is comprised of small airway basal media (SABM) with selected components from SAGM bullet kit (Lonza) including Insulin ...
-
bioRxiv - Immunology 2021Quote: Control or transfected Lymphocytes (with Flag-wt-TDP-43 or Flag-NLS-mut-TDP-43 plasmid (1 μg) using nucleofection kit (Lonza)) were placed on coverslips (2 x 106 cells in sterile glass coverslips-Ø 12 mm ...
-
bioRxiv - Cancer Biology 2019Quote: ... All cells were authenticated by short tandem repeat analysis and confirmed negative for Mycoplasma infection with the MycoAlert Mycoplasma Detection Kit (Lonza). HCT-116 and A549 cells were cultured in DMEM ...
-
bioRxiv - Physiology 2019Quote: ... 10% AIM-V and 100 units/ml penicillin/ streptomycin and transiently transfected using Nucleofector™ Kits for Human Melanocytes (Lonza) or magnetofection with PolyMag Neo magnetic beads (OZ Biosciences) ...
-
bioRxiv - Genetics 2019Quote: ... Electroporation was performed using the Human Adult Dermal Fibroblast Nucleofector™ Kit and the Nucleofector™ II/2b device (Lonza). Both cell lines were harvested 72-hours post-transfection for qRT-PCR ...
-
bioRxiv - Bioengineering 2019Quote: ... and grown in bronchial epithelial growth medium (BEGM) supplemented with SingleQuot additives from Lonza (BEGM Bullet Kit, reference CC-3170) and 50 μg/mL G-418 at 37°C and 5% CO2.
-
bioRxiv - Cancer Biology 2020Quote: ... Their identity was verified by using STR profiling (Eurofins) and lack of Mycoplasma infection was confirmed by Mycoalert Mycoplasma Detection Kit (Lonza). Cell lines were cultured in Dulbecco’s modified eagle’s medium (DMEM):F12-HAM (Sigma ...
-
bioRxiv - Systems Biology 2021Quote: ... All of the cell lines have been periodically subjected to re-confirmation by Short Tandem Repeat (STR) profiling by ATCC and mycoplasma testing by MycoAlertTM PLUS mycoplasma detection Kit (Lonza). A375 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were typically maintained in culture for 1-2 months before thawing of a new batch and mycoplasma screening was performed routinely using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lines were maintained and passaged according to ATCC recommended procedures and regularly tested for mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cancer Biology 2021Quote: ... Both cell lines were authenticated by amplification and Sanger sequencing of the BRCA1 locus harboring the original and secondary mutations and regularly tested for Mycoplasma contamination using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza). The two cell lines were maintained in Ham’s F-12 Nutrient Mixture medium with 5% (vol/vol ...
-
bioRxiv - Microbiology 2022Quote: ... All cell lines were regularly tested to check they were free of mycoplasma contamination using a commercially available system (MycoAlert Mycoplasma Detection kit; Lonza). HCV replication experiments were conducted using the highly permissive human hepatoma cell line Huh7 High Passage (28 ...
-
bioRxiv - Immunology 2022Quote: ... Twenty μl of cells in buffer were transferred to each well of a 16-well Nucleofection cuvette strip (4D-Nucleofector X kit S; Lonza). Three μl of RNP were gently dispensed to each well ...
-
bioRxiv - Cell Biology 2022Quote: ... All tumor cell lines used in the in vivo experiments were routinely tested for mycoplasma contamination using Mycoalert plus mycoplasma detection kit (Lonza). Randomization of animals was not used in experiments and no blinding was done for the animal experiments.
-
bioRxiv - Neuroscience 2021Quote: ... the cell suspension was transfected with a Homer 1c::TdimerDsRed plasmid (Bats et al., 2007) by electroporation using the Amaxa Nucleofector 2b device and Amaxa mouse neuron nucleofector kit (Lonza). Neurons were then plated on poly-L-lysine-coated glass coverslips and grown at 37°C in a humidified 5% CO2-containing atmosphere in BME supplemented with KCl (25 mM final concentration) ...