Labshake search
Citations for Lonza :
3601 - 3650 of 4910 citations for Rat Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and resuspended in EBM™-2 (Endothelial Cell Growth Basal Medium-2, Lonza). 500 μl EGM-2 BulletKit™ culture medium (with full supplements ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting cell pellets were resuspended in 15 µL of nucleofection buffer (Lonza). Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: The hTERT-RPE1 cells (ATCC CRL-4000) were cultured in DMEM medium (Lonza) supplemented with 10% fetal bovine serum (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 x 105 cells were resuspended in 20 µL Nuclofector Solution SF (Lonza), combined with the assembled Cas9 RNPs ...
-
bioRxiv - Cancer Biology 2023Quote: ... NK-92 cell line was maintained in X-VIVO™ 20 medium (Lonza) supplemented with 5% human serum (Sigma Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... OCI-Ly8 or OCI-Ly1 cells were transduced with NucleofectorTM Solution V (Lonza) and the NucleofectorTM2b (Lonza ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were electroporated using program CM-130 on the Amaxa 4D-Nucleofector (Lonza). 80 μL pre-warmed complete DMEM was added to each well and the cells were allowed to initially recover for 10 min at 37°C followed by diluting with DMEM media ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were electroporated using program CM-130 on the Amaxa 4D-Nucleofector (Lonza). 80 μL pre-warmed complete DMEM was added to each well and the cells were allowed to recover for 5 min at 37°C followed by dilution in complete DMEM media for limited dilution to generate clonal cell lines ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were electroporated using program X-001 on the Amaxa Nucleofector II (Lonza). Transfected cells were cultured in DMEM growth media without any antibiotics for 24-48 hrs and then selected for 10 days with 1ug/ml puromycin (Thermo Fisher #A1113803 ...
-
bioRxiv - Bioengineering 2024Quote: ... Cell pellets were resuspended in P3 buffer with 22% supplement (Lonza, Basel, Switzerland), and combined with the RNP+dsDNA mixture ...
-
bioRxiv - Bioengineering 2024Quote: ... Human microvascular endothelial cells (hMVEC) were purchased from Lonza (hMVEC 33226, Walkersville, MD) and used without additional characterization ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were expanded in EGM-2 MV media (EBM-2 supplemented with Lonza’s SingleQuot supplements ...
-
bioRxiv - Genomics 2024Quote: Cells were cultured in smooth muscle growth medium (Lonza; catalog number: CC-3182) supplemented with human epidermal growth factor ...
-
bioRxiv - Genomics 2024Quote: ... The cells were embedded in 0.75% Low-Melting-Point agarose (Lonza #50101, SeaPlaqueTM) in SB buffer (25 mM Tris-HCl ...
-
bioRxiv - Immunology 2024Quote: ... cells were resuspended in 20 μL of P3 buffer mix (#V4XP-3032, Lonza) according to the manufacturer’s protocol and mixed with the 5 μL of pre-incubated Cas9/sgRNA ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2024Quote: ... All cells were tested for mycoplasma prior to use (Lonza, cat. # LT07-218). Proliferation was measured seeding 1,000 cells per well in a 96-well plate with CellTiter Blue (Promega,cat ...
-
bioRxiv - Immunology 2024Quote: ... Harvested BMDMs were resuspended in P3 primary cell nucleofection buffer (V4XP-3024, Lonza) and electroporated with generated Cas9-RNP complexes using supplied nucleofector cuvettes (Lonza ...
-
bioRxiv - Immunology 2024Quote: Cells obtained by crawl-out were glucose-starved for 24h in PBS (Lonza) supplemented with 0.5% fetal calf serum for 8 hours ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were electroporated using program CM-130 on the Amaxa 4D-Nucleofector (Lonza). 80 μL pre-warmed complete DMEM was added to each well and the cells were allowed to initially recover for 10 min at 37°C followed by diluting with DMEM media ...
-
bioRxiv - Cell Biology 2024Quote: ... The pelleted cells were resuspended with 100μl electroporation buffer (Lonza, Cat #: VPG-1001) containing 0.3 nmol nontargeting control siRNA (siRNA scramble ...
-
bioRxiv - Cell Biology 2024Quote: The primary HUVECs (human Umbilical Vein Endothelial Cells) from Lonza (CC-2519, USA) were cultured in EndoGRO (EMD Millipore ...
-
bioRxiv - Pathology 2024Quote: ... The cells were initially cultured for 3-days in ALI-growth medium (Lonza) based on manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... All cell lines were murine pathogen tested and confirmed mycoplasma negative by Lonza MycoAlert™ Mycoplasma Detection Kit.
-
bioRxiv - Immunology 2024Quote: ... Red blood cells were lysed using ammonium-chloride-potassium (ACK) lysis buffer (Lonza).
-
bioRxiv - Immunology 2024Quote: ... lung epithelial cells from FACS (as described above) were resuspended in SAGM (Lonza) mixed 1:1 with growth-factor reduced Matrigel (BD Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... Normal human bronchial epithelial cells (NHBE) from non-smokers were obtained from Lonza and all samples were de- identified ...
-
bioRxiv - Molecular Biology 2024Quote: ... Human primary hepatic stellate cells used for the main experiments were from Lonza (HUCLS ...
-
bioRxiv - Immunology 2024Quote: ... washed with 1x PBS and resuspended in P3 Primary Cell Nucleofection Buffer (Lonza) at a concentration of 5 × 106 cells in 20 μl for each electroporation ...
-
bioRxiv - Molecular Biology 2020Quote: ... This vector and the piggy bac transposase were then nucleofected into H9 using the AMAXA nucleofector kit (Lonza). Puromycin selection started 4 days following nucleofection and the surviving clones were screened by qPCR and Western Blot for NSUN6 expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... All lines were validated by STR analysis yearly and checked for mycoplasma contamination using MycoAlert PLUS kit (Lonza). Conditioned medium was collected by starving sub-confluent cells for 24 h in α-MEM (Gibco).
-
bioRxiv - Microbiology 2019Quote: ... All POLIC variant expression constructs (15 µg) were transfected by nucleofection using the Amaxa Nucleofection Parasite Kit (Lonza) into 29-13 cells to generate inducible overexpression POLIC-PTP variant cell lines (OE ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Cultures were confirmed to be free of mycoplasma infection using the MycoAlert Mycoplasma Detection Kit (Lonza, Walkersville, MD). For the screen ...
-
bioRxiv - Neuroscience 2021Quote: ... coated coverslips in a 24-well plate in 1ml Endothelial Growth Media-2 Bullet Kit (EGM-2; Lonza; Endothelial basal media-2 with 2% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Genetics 2022Quote: ... were cultured in RtEGM with supplement medium as indicated by the manufacturer’s protocol (RtEGM bullet kit, Lonza, #00195409). HfRPE cells were cultured to high confluence on coverglass culture plates (Thermo ...
-
bioRxiv - Cancer Biology 2021Quote: ... fixed after 12 days and stained according to the OsteoImage™ Mineralisation Assay Lonza kit (PA-1503, Lonza) protocol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cultures were confirmed to be free of mycoplasma infection using the MycoAlert Mycoplasma Detection Kit (Lonza, Walkersville, MD). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Cell Biology 2023Quote: ... dermal fibroblasts were expanded and verified mycoplasm negative via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, 75860-362) infected with Sendai virus containing Yamanaka factors from the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (ThermoFisher ...
-
Hallmark molecular and pathological features of POLG disease are recapitulated in cerebral organoidsbioRxiv - Cell Biology 2023Quote: ... Regular monitoring for mycoplasma contamination was performed using the Myco Alert™ Mycoplasma Detection Kit (Lonza, #LT07-218) to ensure the integrity of the cell lines.
-
bioRxiv - Cancer Biology 2024Quote: ... Absence of Mycoplasma contamination was determined at every plating using the MycoAlert kit according to manufacturer’s instructions (Lonza). Cell lines were cultured in 5% CO2 in a humidified atmosphere in 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and were routinely determined to be negative for Mycoplasma infection using a MycoALert detection kit (Lonza #LT07-118).
-
bioRxiv - Biophysics 2021Quote: ... 1% Penicillin/Streptomycin and 20% supernatant of M-CSF expressing L-929 cells (Lonza) in untreated six-well culture plates ...
-
bioRxiv - Biophysics 2021Quote: ... 1 % L-Glutamine and 20 % supernatant of M-CSF expressing L-929 cells (Lonza).
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were immediately nucleofected using the Lonza 4D-Nucleofector™ × Unit (Lonza, #AAF-1002X) with the EN150 program ...
-
bioRxiv - Cell Biology 2020Quote: ... FADS 1 cells were grown in Minimum Essential Medium (MEM) Alpha (Lonza, Basel, Switzerland) supplemented with 15% foetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... and maintained in endothelial cell medium-2 (EGM-2 - Clonetics, Lonza, Walkersville, MD, USA) supplemented with endothelial growth medium (EGM ...
-
bioRxiv - Immunology 2021Quote: Peripheral blood mononuclear cells (PBMCs) were isolated using Histopaque density 1.077 g/mL (Lonza). CD14+ cells were sorted with the MACS system (Miltenyi Biotec) ...
-
bioRxiv - Microbiology 2019Quote: Embryonic monkey kidney cells (MA104) were grown in M199 complete medium [Medium 199 (Lonza) and 1% penicillin-streptomycin (P/S ...
-
bioRxiv - Bioengineering 2022Quote: ... 12 mm transwell inserts (Falcon) at 200,000 cells/cm2 and cultured in EGM2 (Lonza) at 37°C and 5% CO2 for 48 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells (2 × 105) were resuspended with SF buffer (V4XC-2032, Lonza, Basel, Switzerland) and pulsed with purified SpyCas9 (20 pmol).