Labshake search
Citations for Lonza :
301 - 350 of 9698 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Cell Biology 2024Quote: ... and sgRNAs (see Key Resources Table) were delivered by nucleofection to a single cell suspension of 105 iBCs in Primary Cell P3 solution (Lonza, #V4XP-3032). Cells were re-cultured and the resulting clonally-derived spheroids were isolated ...
-
bioRxiv - Cell Biology 2024Quote: Nucleofector 2b Device (Lonza, Colmar, France) and the Cell line Nucleofector Kit T (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: ... and the Cell line Nucleofector Kit T (Lonza, VCA-1002) were used for the plasmids cells transfections (1-5 µg) ...
-
bioRxiv - Cell Biology 2024Quote: ... The supernatant was centrifuged at 300 g for 5 min and cells resuspended in X-VIVO152 (Lonza), OXM4 or HPLM (A4899101)3 supplemented with 100 ng/ml hM-CSF and plated at 4×106 cells per 10 cm petri dish to differentiate over 7 days ...
-
bioRxiv - Cell Biology 2024Quote: ... the medium was switched to Hepatocyte Culture Medium (HCM; CC-3198, Lonza, Switzerland) with 10 ng/mL hepatocyte growth factor (HGF ...
-
bioRxiv - Cell Biology 2024Quote: ... hMBs were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza) as a growth medium (GM ...
-
bioRxiv - Cell Biology 2024Quote: ... and 0.64 pmol of ssDNA by Nucleofector II (Lonza) or Neon Transfection System (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... All cells were routinely checked for mycoplasma contamination using the MycoAlertTM Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... or DMEM (Lonza) for protein purification ...
-
bioRxiv - Cell Biology 2024Quote: ... containing EGM SingleQuots supplements (Lonza) (without ascorbic acid ...
-
bioRxiv - Cell Biology 2024Quote: Pooled HUVECs were purchased from Lonza and cultured in Endothelial Cell Basal Medium (EBM) (Lonza) containing EGM SingleQuots supplements (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: Pooled HUVECs were purchased from Lonza and cultured in Endothelial Cell Basal Medium (EBM ...
-
bioRxiv - Cell Biology 2024Quote: ... Large scale D.Mel-2 cultures were prepared by diluting cells to a density of 106 cells/mL in Insect Xpress culture medium (Lonza) in Erlenmeyer flasks ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were routinely tested for Myocoplasma contamination (MycoAlert; Lonza).
-
bioRxiv - Cell Biology 2024Quote: Primary human lung microvascular endothelial cells (HMVEC-L) were purchased from Lonza (CC-2527). HMVEC-L were cultured in EGMTM-2MV Microvascular Endothelial Cell Growth Medium-2 BulletKitTM (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: ... HMVEC-L were cultured in EGMTM-2MV Microvascular Endothelial Cell Growth Medium-2 BulletKitTM (Lonza, CC-3202) at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: The commercially available human myoblast (hMB) stock isolated from a healthy 35-year-old female (CC-2580, lot 0000483427; Lonza, Walkersville, MD, USA) was used [7,10] ...
-
bioRxiv - Cell Biology 2024Quote: Primary human aorta ECs (HAEC) were purchased from Lonza at an early passage (passages <4 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected using Amaxa nucleofector (Lonza) using the manufacturer’s protocol T-20 ...
-
bioRxiv - Cell Biology 2024Quote: ... 200mM L-glutamine (Lonza, Switzerland), 1% penicillin-streptomycin (Thermofisher ...
-
bioRxiv - Cell Biology 2024Quote: ... Primary normal human lung fibroblasts (NHLF, Lonza CC-2512) were cultured in Dulbecco’s Modified Eagle Medium (Corning #10-017-CV ...
-
bioRxiv - Cell Biology 2024Quote: ... and 100 mg/mL streptomycin (Lonza). OVKATE and OVSAHO cell lines were cultured in RPMI 1640 medium (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... in complete EGM-2 (Lonza CC-3162). Primary normal human lung fibroblasts (NHLF ...
-
bioRxiv - Neuroscience 2024Quote: ... DAPT (cat# 2088055, Peprotech/Lonza, Sydney, Australia), brain-derived neurotrophic factor (BDNF ...
-
bioRxiv - Systems Biology 2024Quote: ... and finally resuspended in a cold SSC cocktail (3× Lonza AccuGENE SSC ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1x penicillin/streptomycin (Lonza). Cells were maintained at 371°C in the presence of 5% CO2 and tested for mycoplasma contamination regularly ...
-
bioRxiv - Immunology 2024Quote: ... Tb1 Lu cells were cultures in EMEM growth medium (Lonza, 12611F), with the conditions mentioned above ...
-
bioRxiv - Neuroscience 2024Quote: ... sgRNA plasmids validated by Sanger sequencing were transfected into SH-SY5Y cells using nucleofection (SF Cell Line 4D-Nucelofector X kit, Lonza, Germany, V4XC-2012) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Trypsin was inactivated by adding an equal volume of DMEM/F12 containing 20% FBS (Lonza, Bio Whittaker). Cerebral cortex was dissociated by trituration in DMEM/F12 containing 10% FBS and 20 µg/ml DNase I (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... Two million E14 ESCs were nucleofected with paired Kdm3b targeting and donor plasmids (5 µg each) using the Amaxa 4D-Nucleofector protocol (Lonza) and selected with blasticidin S hydrochloride (Research Products International ...
-
bioRxiv - Physiology 2024Quote: ... Cells were nucleofected using the Amaxa 4D nucleofector (Lonza) with pre-annealed ribonucleoprotein complexes of sgRNAs and recombinant Cas9 protein (IDT ...
-
bioRxiv - Cell Biology 2024Quote: ... and penicillin/streptomycin (Lonza Bioscience) to prevent contamination ...
-
bioRxiv - Developmental Biology 2024Quote: HUVECs were purchased from Lonza, and the HCMEC/D3 cell line was obtained from Millipore ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were routinely tested for mycoplasma with MycoAlert Mycoplasma Detection Kit (Lonza) as per manufacturer instructions.
-
bioRxiv - Bioengineering 2024Quote: ... cells were cultured in endothelial growth medium (EGM-2, Lonza) on 0.1% gelatin-coated plates in a humidified incubator with 5% CO2 at 37°C until passage 1.
-
bioRxiv - Bioengineering 2024Quote: ... are commonly used as an experimental model for human hearts due to their anatomical and structural similarities and convenient availability.36–38 Cells were cultured on tissue culture treated flasks with Endothelial Growth Medium-2 (EGM-2, Lonza), which was changed every other day until the cells reached ∼75% confluence ...
-
bioRxiv - Biochemistry 2024Quote: ... were cultured in EGM2TM BulletKitTM medium (Lonza Switzerland, CC-3162) and grown at 37°C at 5% CO2 ...
-
bioRxiv - Bioengineering 2024Quote: Commercially available normal adult human dermal fibroblasts (NHDF-Ad Lonza CC-2511, Lot 545147) were used up to passage 6 to generate the tissues ...
-
bioRxiv - Immunology 2024Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Extended Data Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Immunology 2024Quote: ... and the AMAXA Nucleofector System (Lonza) program Y001 for human monocyte transfection according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then passaged as previously described and 8×105 cells were resuspended in 100 µl of nucleofector solution (Lonza, VPH-5012). Depending on the experiment ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were regularly verified as mycoplasma negative (MycoAlert mycoplasma detection kit; Lonza, LT07-118) and authenticated by STR profiling at the Australian Genome Research Facility.
-
bioRxiv - Microbiology 2024Quote: ... THP-1 cell line was routinely tested for mycoplasma contamination (Mycoalert mycoplasma detection kit, LONZA). To differentiate monocytic THP-1 into adherent macrophages ...
-
bioRxiv - Physiology 2024Quote: ... Primary human skeletal muscle cells were obtained from Lonza (SkMC, #CC-2561) and the Hospices Civils de Lyon and were cultured in growth medium consisting of DMEM/F12 (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... Adult brains were embedded in 4% low melting point agarose (50100, Lonza) and sectioned (70 μm ...
-
bioRxiv - Cancer Biology 2024Quote: Mycoplasma was monitored with MycoAlert® PLUS Mycoplasma Detection Kit (Lonza, Cat# LT07-705) in April 2022 and the cell line was used in February 2023 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were confirmed to be mycoplasma-free based on a luminescence-based enzymatic assay (MycoAlert®, Lonza, Cat# LT07-118) conducted within 1 week of the commencement and completion of the experiments ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1e6 cells were loaded across two different nucleocuvettes with SE reagent and electroporated under program CL-120 on a 4D-Nucleofector X Unit (Lonza, NC0475784). Following puromycin selection at 2µg mL-1 (InvivoGen ...