Labshake search
Citations for Lonza :
1301 - 1350 of 1408 citations for 5 Bromobenzothiazole 2 sulfonic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... siRNAs were added to 2 µM and electroporation was performed using the program U-001 on the 3D-Nucleofector (Lonza). The siRNAs targeting Clever-1 ...
-
bioRxiv - Cancer Biology 2024Quote: Whole bone marrow cells were obtained by flushing one femur with PBS 2% FBS followed by erythrocyte elimination with ACK Lysing Buffer (10-548E, BioWhittaker, Lonza). The remaining cells were filtered through 40 μm pore size cell strainer and counted ...
-
bioRxiv - Cancer Biology 2024Quote: Bone marrow cells were obtained by flushing two femurs of each NSG mouse with 2% FBS in PBS followed by erythrocyte elimination with ACK Lysing Buffer (10-548E, BioWhittaker, Lonza). Cells filtered through 40 μm strainer were counted and 1×106 cells/well were stained with Live/Dead Blue (Thermo ...
-
bioRxiv - Immunology 2024Quote: ... PBMC vials were thawed in the 37 °C water bath for 1-2 minutes and resuspended in warm X-VIVO 10 serum-free cell-media (Lonza). Samples were washed by centrifugation for 12 minutes at 1200 rpm at room temperature (RT) ...
-
bioRxiv - Bioengineering 2024Quote: ... Unlabelled HUVECs or HUVEC with a constitutive green fluorescent protein (GFP) reporter (CMV-GFP HUVEC, ATCC) were cultured in EGM-2 Bulletkit medium (Lonza) and used before 10 passages ...
-
bioRxiv - Neuroscience 2024Quote: ... The CD146-positive cells remaining in the column were collected and cultured on collagen type I-coated dishes in in endothelial basal medium (EBM-2, Lonza) supplemented with endothelial growth factors EGM-2 SingleQuots (Lonza).
-
bioRxiv - Cell Biology 2024Quote: PC-3 cells (1 × 106 cells) were transfected with 2 μg of mGFP-GPI cDNA using a 4-D nucleofector (LONZA) and cultured in two 150-mm dishes until reaching approximately 100% confluence (2 × 107 cells) ...
-
bioRxiv - Bioengineering 2024Quote: ... The mixture was transferred to a confocal plate and subsequently UV crosslinked at 15 mW/cm2 for 1 minute and cultured for 4 days in EGM-2 media (Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were cultured at 37°C and 5% CO2 in DMEM (H3BE12-604F/U1, Lonza Group AG [Cultek S.L.U, Madrid, Spain]) supplemented with 10% tetracycline-free FBS (631106 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Microbiology 2020Quote: ... The final extension step was extended for 5 minutes and product size was confirmed by electrophoresis with a FlashGel™ DNA Kit (Lonza, Basel, Switzerland). PCR products were then purified with the DNA Clean & Concentrator kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells are spun at 1250 x g for 5 minutes and resuspended in 25 µl Lonza SF buffer (Lonza Cat. No. V4SC-2960) if cycloheximide selection will not be used or 200 µl of SF buffer if cycloheximide selection will be used.
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Immunology 2023Quote: ... Cells were cultured at 37°C with 5% CO2 and were regularly tested for mycoplasma contamination using the MycoAlert® PLUS Mycoplasma Detection Kit (Lonza, LT07-703), and authenticated by Microsynth ...
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expanded in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 12.5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Synthetic Biology 2021Quote: ... and γδ T cells were activated at 1 x 106 cells mL-1 for 2 days in complete XVivo15 medium (Lonza) (5% fetal bovine serum ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated with enhancer (IDT, #1075915, final concentration 4 μM) in a nucleofector device (Lonza, Nucleofector 2; program D-032). Cells were incubated for 24 h to allow them to recover and then detached and cloned by serial dilution ...
-
bioRxiv - Immunology 2022Quote: ... The concentration of IL-2 was increased to 1000 IU/ml on day 7 and the expanded T cells were electroporated with the indicated mRNA at a concentration of 2 pg mRNA/cell on day 8 using 4D Nucleofector™ System (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... pcDNA3-JUP or empty vector were transfected into Caco-2 cells using SE Cell Line 4D-Nucleofector™ X Kit (Lonza) and an Amaxa 4D Nucleofector device from Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... expressing the human CD133 antigen45 was co-delivered with a PBase expression vector (2.5 μg) into 2 ⨯ 106 U251 cells using Nucleofector 2b (Lonza, Köln, Germany), followed by puromycin (500 ng/ml ...
-
bioRxiv - Bioengineering 2020Quote: 2 million UCB-MNC/mL were cultured in X-VIVO 15 serum-free cell-culture medium (Lonza Group Ltd, Basel, Switzerland), supplemented with 0.5 μg/mL of FMS-like tyrosine kinase-3 and 0.5 μg/mL of stem-cell factor ...
-
bioRxiv - Bioengineering 2022Quote: ... the basal channels of the Intestine Chips were first rinsed with endothelial cell culture medium consisting of stem cell medium supplemented with components from EGM™-2 MV Microvascular Endothelial SingleQuots Kit (CC-4147; Lonza), and then 50 μL HIMECS (450,000 cells/chip ...
-
bioRxiv - Genomics 2021Quote: ... The medium was changed to fresh fibroblast medium containing β-mercaptoethanol on day 2 and to a defined hepatocyte growth medium (HCM, Lonza) on day On day 6 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Days 5-10 (hepatoblast differentiation/ Stage 2) switched to complete Hepatocyte Culture Medium (HCM) (consisting of HBM Basal Medium and HCM SingleQuot Supplements (Lonza, UK)) containing 20 ng/ ml BMP2 and 30 ng/ ml FGF2 (both Peprotech) ...
-
bioRxiv - Pathology 2020Quote: ... The purity of the final recombinant proteins was determined to be more than 99% by sodium dodecyl sulfate and polyacrylamide gel (SDS-PAGE) with an endotoxin concentration lower than 2 units/mg protein measured by Limulus Amebocyte Lysate PYROGENT™ 125 Plus (Lonza). In previous experiments we demonstrated that these recombinant proteins were functionally devoid of significant endotoxin contamination ...
-
bioRxiv - Immunology 2020Quote: ... The inoculum was then removed and replaced with 2 mL of complete DMEM medium with 1% SeaPlaque agarose (Lonza, Cat# 50100). The plate was incubated at 37°C and 5% CO2 for 3 days ...
-
bioRxiv - Biochemistry 2021Quote: ... 500,000 cells were seeded per well and 2 days later the experiment was started by replacing the culture medium with 2.5 ml Pro293a medium (Lonza, Basel, Switzerland), supplemented with 2 mM L-glutamine and 100 units pen/strep (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... and Subset Four (podoplanin+CD36+) were sorted into 5mL FACS tubes containing endothelial basal media (EGM-2 medium without supplements added, Lonza, USA) supplemented with 10% FBS at 4°C degrees ...
-
bioRxiv - Physiology 2022Quote: ... A second enrichment with anti-CD102-coated Dynabeads was performed before culturing cells at 37Cº on fibronectin-coated tissue culture dishes in EGM-2 media (Lonza Walkersville). Cells (passage two ...
-
bioRxiv - Neuroscience 2024Quote: ... digested for 3 min at 37 °C in Accutase and then resuspended in 60 μL nucleofection buffer from the Human Stem Cell Nucleofector™ Kit 2 (Lonza). The suspension was combined 2 μM Electroporation Enhancer (IDTDNA ...
-
bioRxiv - Microbiology 2024Quote: ... falciparum strains were cultured at 2% haematocrit in O+ erythrocytes and RPMI-1640 medium (Lonza, BE12-167F or Gibco, 31870-025) supplemented to give the following final concentrations ...
-
bioRxiv - Molecular Biology 2024Quote: ... HSVECs were obtained by enzymatic collagenase digestion of human saphenous veins (Ethics 15/ES/0094) and maintained in EC growth medium (EGM-2 BulletKit™) (Lonza) supplemented with foetal bovine serum (10% ...
-
bioRxiv - Immunology 2024Quote: ... and spun at 200xg for 10 min and resuspended at a concentration of 2-10x106 cells/100µL in Lonza Buffer P3/supplement (Lonza #V4XP-3024). The RNP complex and 100µL of resuspended cells were combined and electroporated using pulse code EO-115 on the Lonza 4D-Nucleofector Core/X Unit.
-
bioRxiv - Microbiology 2024Quote: ... Passage 2 cells were transferred to 75 mL flasks and grown in confluence in Dulbecco Modified Eagle medium (DMEM) (Lonza BioWhittaker) containing 10% heat-inactivated fetal bovine serum (Gibco ...
-
bioRxiv - Bioengineering 2024Quote: ... HepG2 and K562 cells (2×105 cells/condition) were electroporated using the SF Cell Line 96-well Nucleofector™ Kit (Lonza) and the CM-130 ...
-
bioRxiv - Immunology 2023Quote: ... vectors was performed on day 2 of activation into 1×106 T cells using 4D-Nucleofector according to the manufacturer’s instructions (Lonza, Cologne, Germany).
-
bioRxiv - Cell Biology 2023Quote: ... Human visceral pre-adipocytes were purchased from Lonza (PT-5005) and cultured according to the manufacturer’s instructions in PGM-2TM Preadipocyte Growth Medium-2 BulletKitTM from Lonza (PT-8002). Once cells were expanded ...
-
bioRxiv - Cancer Biology 2023Quote: ... HUVEC cells were maintained in growth factor-supplemented media (EBM + EGM-2 aliquots + 10% FBS) from Lonza (C-3121, CC-4542). MDA-MB-231 cell line was modified to express GFP (green fluorescent protein ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were infected with virus dilutions (from 10-1 to 10-9) prepared in DMEM supplemented with 2% FBS and 1%Penicillin/Streptomycin mixture (Lonza Biosciences). Infected cells were incubated at 37°C for 7 to 15 days ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μL of the final 100 μM siRNA duplex was mixed with 100 μL of Nucleofection solution V (Lonza, VVCA-1003) and transfected into 10 million cells using a NucleofectorTM 2b Device and program T-029 (Lonza) ...
-
bioRxiv - Cancer Biology 2024Quote: ... K562 and NALM6 cells (2×105 cells/transfection) were transfected using a Lonza 4D nucleofector™ with a SF nucleofection kit (Lonza) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μL of the final 100 μM siRNA duplex was mixed with 100 μL of Nucleofection solution V (Lonza, VVCA-1003) and transfected into 4 million cells (48 h knockdown ...
-
bioRxiv - Bioengineering 2024Quote: ... Liver sinusoidal endothelial cells were isolated using CD146 microbeads (Miltenyi Bio 130-092-007) according to manufacturer’s instructions and cultured in EBM-2 media with supplements (Lonza CC-3162). LSECs were plated at 2×104 cells per well in 96-well tissue culture plates ...
-
bioRxiv - Biochemistry 2024Quote: ... Stable cell lines containing an empty vector or HA-labeled H2B variant were derived by electroporating ∼1 x 106 MCF10A cells and 2 µg of the minigene plasmid with a Lonza 4D-Nucleofector® X Unit (Lonza) and SF Cell Line 4D-Nucleofector™ X Kit S (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: ... The reagents were mixed with 1 million cells resuspended in 100 μl human stem cell buffer kit 2 (Lonza, VCA-1005); the cells were electroporated using the Amaxa nucleofector IIb program B-016 ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines were cultured at 37°C and 5% CO2 and tested for mycoplasma contamination using a MycoAlert® mycoplasma detection kit (Lonza, cat: LT07-218). Only mycoplasma-negative cells were used.