Labshake search
Citations for Lonza :
1001 - 1050 of 1408 citations for 5 Bromobenzothiazole 2 sulfonic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Cancer Biology 2024Quote: ... Red blood cell lysis was performed for 5 min at room temperature in ACK lysing buffer (Lonza, #10-548E). For flow cytometry ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Biochemistry 2023Quote: Plasma cholesterol was depleted by treating HEK293 cells with 5 mM MβCD for 30 min in Pro293A-CDM (Lonza); this short period of MβCD treatment was deemed sufficient to removed 50% of endogenous cholesterol from cells (34) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2024Quote: Human HeLa cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP were formed by mixing 5 to 9 μgr base editor protein with 1.5 μgr of sgRNA in 20 μL of P3 buffer (Lonza, Amaxa P3 Primary Cell 4D-Nucleofector Kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were pelleted at 1000 rpm for 5 min and resuspended in 100 μL nucleofector solution (Lonza, #VPB-1002) before adding 2.5 μg of plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... were cultured at 37°C and 5% CO2 in EGMTM Endothelial Cell Growth Medium with BulletKitTM (Lonza CC-3124) and 1x antibiotic-antimycotic (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... Cas9-gRNA ribonucleoproteins were assembled as described previously53 and nucleofected into 5×106 monocytes in 100μL nucleofection buffer (Human Monocyte Nucleofection Kit, Lonza) using a Nucleofector 2b (Lonza ...
-
bioRxiv - Genomics 2023Quote: ... Cells were grown at 37°C and 5% CO2 and passed with Hepes buffered saline solution (Lonza, CC-5024) and 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: Primary human alveolar epithelial cells (HPAECs, CellBiologics) were cultured at 37°C and 5% CO2 with SABM medium (Lonza), SAGM supplements (Lonza) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Biochemistry 2024Quote: Human lung carcinoma A549 cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2024Quote: Primary human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Synthetic Biology 2021Quote: ... This mixture was nucleofected with 2×106 stimulated human primary T cells using the 4D-Nucleofector (Lonza) with the program EO-115 ...
-
bioRxiv - Genomics 2021Quote: ... PBMCs were then treated with 2 ml of erythrocytes lysis buffer (Lonza Walkersville inc. #120-02-070) for 1 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were cultured on laminin-coated tissue culture flasks in SKGM-2 medium (Lonza®, Valkersville, MD). Medium was replaced every 3 days ...
-
bioRxiv - Genetics 2020Quote: ... Parasites were subsequently resuspended in 100 μL nucleofector solution of the Basic Parasite Nucleofector Kit 2 (Lonza), combined with 50 μL plasmid solution containing 5-10 μg DNA ...
-
bioRxiv - Bioengineering 2021Quote: Human umbilical vein endothelial cells (ECs) were cultured in endothelial growth medium (EGM-2; Lonza, Basel, Switzerland) supplemented with 1% penicillin-streptomycin-fungizone (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... The overlay medium contained either DMEM with 2% FBS and 1% sea-plaque agarose (Lonza, Walkersville, MD) in the case of in vitro samples or Opti-MEM with 2% FBS ...
-
bioRxiv - Microbiology 2021Quote: Each transfection reaction was prepared by adding 2 µl of “primed” cells resuspended in SG buffer (Lonza) to a mixture of ...
-
bioRxiv - Cell Biology 2020Quote: ... were cultured at 1000-1500 cells/mm2 on 1% gelatin-coated dish in EGM-2 medium (Lonza) and used before passage 9 ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of plasmids were performed 2 days before experiments using the Amaxa nucleofector (Lonza VPD-1004). The cells were detached with trypsin/EDTA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 × 105 cells* ml) in 2 ml of Insect-Xpress medium (Lonza, Walkersville, MD, USA) were transfected with recombinant bacmids using Cellfectin reagent (Life Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... in EBM-2 medium supplemented with EGM-2MV SingleQuots (Lonza, Cat No CC-3156 and CC-4147) in an incubator set to 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the digested splenic cells were cultured in endothelial cell growth medium EGM-2 (Cat# CC-3162, Lonza) at a density of 2-5 × 104/mL in fibronectin-coated culture flasks for 24 hours ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Human umbilical venous endothelial cells (HUVECs) and EGM-2 bullet kits were obtained from Lonza (Basel, Switzerland).
-
bioRxiv - Cell Biology 2020Quote: ... Primary human pulmonary arterial smooth muscle cells (PASMCs) were cultured in SmGM-2 cell culture media (Lonza), and experiments were performed at passages 3 to 9 ...
-
bioRxiv - Immunology 2021Quote: ... 2 × 106 cells were suspended in 100 µL buffer (P3 Primary Cell 4D-Nucleofector X Kit, Lonza), mixed with 4 µg DNA and transfected using the 4D-Nucleofector program DN-100 ...
-
bioRxiv - Cell Biology 2022Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Cell Biology 2024Quote: ... Eye enucleations were completed under aseptic conditions and maintained in EBM-2 media (CC-3156, Lonza, USA). All connective tissue was removed from the external part of the eyes and then the cornea ...
-
bioRxiv - Cell Biology 2024Quote: ... HMVEC-L were cultured in EGMTM-2MV Microvascular Endothelial Cell Growth Medium-2 BulletKitTM (Lonza, CC-3202) at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 × 105 to 2 × 105 cells were collected and resuspended in 15 µL of nucleofection buffer (Lonza). For each reaction ...
-
bioRxiv - Microbiology 2023Quote: Caco-2 cells (human intestinal epithelial cell line) were cultured in DMEM - Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: Primary NHLF were purchased from Lonza and subcultured for up to six passages in manufacturer supplied growth medium (FGM-2 BulletKit, CC3132, Lonza). The microtissues populated with NHLF were grown for 2 d before the addition of M2 macrophages at a ratio of 4:1 (M2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... M0 cells were then serum starved for 2 hours in X-VIVO™ hematopoietic cell medium (Lonza, Basel ...
-
bioRxiv - Neuroscience 2023Quote: ... HUVECs were transfected with 2 μg of RNF213 WT or R4810K construct using electroporation (Lonza, Basel, Switzerland), following the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2023Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼2 million cells were electroporated using the T-020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Cell Biology 2024Quote: ... HMVEC-L were cultured in EGMTM-2MV Microvascular Endothelial Cell Growth Medium-2 BulletKitTM (Lonza, CC-3202) at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were thawed and expanded in EGM-2 endothelial cell growth medium (Lonza, cat. no. CC-3124) for two passages (P-2 ...
-
bioRxiv - Bioengineering 2024Quote: Human umbilical vein epithelial cells (HUVEC, ATCC) were cultured in GM-2 Endothelial Cell Growth Medium (Lonza) supplemented with 1% Pen-Strep at 37° C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... M0 cells were then serum starved for 2 hours in X-VIVO™ hematopoietic cell medium (Lonza, Basel ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were maintained at 37°C and 5 % CO2 in a humidified atmosphere and routinely tested to be mycoplasma negative (MycoAlert Mycoplasma Detection Kit, Lonza). Cells were cultured no longer than 15 passages before experimental use.
-
bioRxiv - Neuroscience 2021Quote: ... Cells were resuspended and transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution in a 25 µL electroporation cuvette (Lonza). Electroporation of GCaMP mutants was performed according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... 3 x 107 bloodstream form cells were harvested by centrifugation and transfected with 5-10 μg of linearized plasmid DNA using an Amaxa Nucleofector II (Lonza) with program X-001 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution electroporation cuvettes (Lonza). Electroporation was performed according to the manufacturer instructions ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...