Labshake search
Citations for Lonza :
1001 - 1050 of 1445 citations for Cis Dcca 100 Ug Ml In Acetonitrile D3 1 Carboxyl 13C2 99%; 1 D 97% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 12ug/ml Bovine Brain Extract (Lonza CC-4098), 10ng/ml hEGF (Sigma E9644) ...
-
bioRxiv - Microbiology 2020Quote: ... the RNP complexes were added to 1×105 cells in 40 μl of P3 nucleofection buffer from the 4D-Nucleofector X kit (Lonza). Half of the mixture was loaded to each well of a 16-well nucleofection cassette and nucleofected using the using E0-100 program with the 4D-Nucleofector Lonza Amaxa ...
-
bioRxiv - Genomics 2020Quote: ... Transfection of these iPSCs with the plasmid and Super piggyBacTM transposase mRNA (Transposagen) was done using the Human Stem Cell Nucleofector Kit 1 (VAPH-5012) by Nucleofector 2b Device (AAB-1001, Lonza) according to the manual ...
-
bioRxiv - Immunology 2021Quote: ... suspension CHO cells expressing wildtype human CTLA-4 were plated at 1 × 106 cells/well in DPBS (Lonza, Basel, Switzerland) containing 0.5% BSA (MilliporeSigma ...
-
bioRxiv - Immunology 2021Quote: Control or transfected Lymphocytes (with Flag-wt-TDP-43 or Flag-NLS-mut-TDP-43 plasmid (1 μg) using nucleofection kit (Lonza)) were placed on coverslips (2 x 106 cells in sterile glass coverslips-Ø 12 mm ...
-
bioRxiv - Genomics 2020Quote: 5 × 105 THP-1 cells were resuspended in 20µL nucleofection solution (16.4µL SG nucleofector solution + 3.6µL supplement 1) from the SG Cell Line 4D-Nucleofector™ X kit (Lonza, V4XC-3032). 300pmol PPP2R1A sgRNA (Synthego ...
-
bioRxiv - Neuroscience 2019Quote: ... Ganglionic eminences and cortex were dissected and dissociated cortical neurons were nucleofected with ON-TARGET plus mouse Mecp2 siRNA or Non-targeting siRNA 1 (Dharmacon) according to the protocol of Amaxa Nucleofection (Lonza). Then neurons were plated into microchambers coated with poly-D-lysine (0.1 mg/ml ...
-
bioRxiv - Immunology 2021Quote: ... The remaining tissue was minced and digested with stirring for 60 min in complete RPMI (RPMI1640; Lonza; supplemented with 10% fetal calf serum (FCS, 1% Pen/Strep; Lonza) containing 0.25 mg/ml Liberase TL (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... Patients-derived iPS cells were electroporated with plasmids and single stranded DNA donor oligos using Human Stem Cell NucleofectorTM Kit 1 (Lonza). After 36 hours ...
-
bioRxiv - Plant Biology 2021Quote: ... the pollinated style was excised with a razor 5 mm above the ovary and placed horizontally on the aforementioned pollen germination medium solidified with 1% (w/v) NuSieve GTG Agarose (Lonza), followed by incubation at 25–30°C for 20 h under humid ...
-
bioRxiv - Microbiology 2021Quote: ... duncani parasites were maintained in A+ hRBCs (American Red Cross) at 5% hematocrit in HL-1 base medium (Lonza 344017) supplemented with 20% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: 2×106 Elijah cells were washed in PBS and resuspended in 20 μl P3 Primary Cell Nucleofector Solution buffer prepared with Supplement 1 buffer (Lonza) according to the manufacturer’s instructions (P3 Primary Cell 4D-Nucleofector X Kit S) ...
-
bioRxiv - Systems Biology 2020Quote: ... 24 hours activated DC and T cells were incubated in 96 well plates at a DC/T ratio 1:5 in Xvivo15 medium (Lonza). After 6 days ...
-
bioRxiv - Immunology 2021Quote: ... MICB or ULBP-1 genes after optimizing nucleofection conditions using primary cell 4D nucleofector kit and 4D nucleofector system (Lonza). After 48 hours of culture ...
-
bioRxiv - Microbiology 2022Quote: ... Ribonucleoproteins were introduced into 1 × 106 sub-confluent BlaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Immunology 2022Quote: ... COPD or smoker human donors (Table 1) were grown using Bronchial Epithelial Growth Media (CC-3170) and harvested using ReagentPack Subculture reagents (CC-5034) (Lonza). BEAS-2B bronchial epithelial cells were obtained from the American Type Culture Collection (ATCC CRL-9609 ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μg of the pSAG1::Cas9-U6::sgUPRT vector15 and 10 μg of the barcode oligo (equivalent to an ~1:160 molar ratio of plasmid to oligo) were co-transfected into approximately 1×106 extracellular tachyzoites using the 4D-Nucleofector X Unit programme F1-115 (Lonza). 24 hours post-transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... and TILs were resuspended at a cell density of 1 million cells in 20 µL P3 electroporation buffer with supplement (Lonza) and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma ...
-
bioRxiv - Immunology 2020Quote: ... Rinsed cells were resuspended in buffer P4 (mouse) or P2 (human) at 1-10 x 106 cells/20 μL (Lonza). Non-targeting Alt-R crRNA #1 ...
-
bioRxiv - Neuroscience 2021Quote: ... dissociated with Accutase and then transfected with one of the Tau or Tubulin pUCM vectors along with AAVS1 TALEN pairs using a Human Stem Cell Nucleofector Kit 1 (Lonza) with the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... 1*106 purified naïve T-cells were resuspended in 15 μL buffer P3 + 5 μL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7 μL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... The guide RNA vector was then electroporated into the parent line containing the CRISPRi system using the Human Stem Cell Nucleofector Kit 1 solution with the Amaxa nucleofector 2b device (Lonza). Nucleofected cells were then seeded into a 6-well plate in mTeSR™-1 supplemented with Y-27632 (10 μM ...
-
bioRxiv - Immunology 2020Quote: 2×106 freshly isolated primary B cells were washed in PBS and resuspended in 20 μl P3 Primary Cell Nucleofector Solution buffer prepared with Supplement 1 buffer (Lonza) according to the manufacturer’s instructions (P3 Primary Cell 4D-Nucleofector X Kit S) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lung cancer cell lines (H3122, H2228, A549, H460, Calu-1, and H1437) were cultured in RPMI-1640 (Lonza, 15-1675) supplemented with 10% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: 3T3-L1 fibroblasts were maintained in DMEM supplemented with 10% newborn calf serum (NCS) and 1% penicillin/streptomycin (P/S) (all Lonza). Experiments were performed in six-well plates ...
-
bioRxiv - Cell Biology 2020Quote: ... The purity of CyaA batches is higher than 90% as judged by SDS PAGE analysis and contained less than 1 EU of LPS/μg of protein as determined by a standard LAL assay (Lonza). Finally ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stable LBH-overexpressing BT549 cell lines were generated by nucleofection of 2×106 BT549 cells with 2 μg linearized pCDNA3 or pCDNA3+Lbh 13 and 1 μg pEGFP (Lonza) in Solution V (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... HUVEC cells were cultured on a 1% gelatin coated surface in EGMTM-2 Endothelial Cell Growth Medium-2 BulletKitTM (Lonza) following the manufacturer’s instructions with an additional 6% FBS ...
-
bioRxiv - Immunology 2021Quote: ... 1 × 106 NALM6 target cells were transfected with 1 μg plasmid using the Nucleofector 4D (SF cell line Kit, program CV-104, Lonza) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: African green monkey kidney epithelial BSC-1 cells (ATCC CCL-26) were maintained in Eagle’s minimal essential medium (EMEM; Lonza, Inc.) containing 5% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... This plasmid was nucleofected into the NGN2 iPS line (obtained as described above) using a nucleofection kit (Human Stem Cell Nucleofector Kit 1, VPH-5012, Lonza) containing 4 μg of RFP PB construct and 1 μg of dual helper plasmid ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were nucleofected with 1 nmol ASO against MERVL or Scramble ASO using P3 Primary Cell 96-well Nucleofector Kit (Lonza) according to manufacturer’s instruction and seeded into each well of a 24-well plate containing 500 µl of ESC medium with 2i ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were plated at 1 × 104/well in black 96-well plates using Bio Whittaker HBSS (BE10-527F, Lonza, Switzerland) with 4.5 g/L glucose ...
-
bioRxiv - Cancer Biology 2022Quote: ... and resuspended in a mixture of 16.4 µl SF cell line solution and 3.6 µl supplemental solution-1 (Lonza, V4XC-2032). The sgRNA and Cas9 ribonuclease protein complex under incubation was then mixed with the cell suspension and 20 µl of it was put a cuvette and nucleofected using 4D-Nucleofector (Lonza ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
bioRxiv - Biochemistry 2022Quote: ... Baculoviral P3 stock was used to infect Sf9 insect cells at 1.5 × 106 cells·mL-1 in Insect-XPRESS media (Lonza #12-730Q) supplemented with 2% FBS (Capricorn #FBS-12A) ...
-
bioRxiv - Cell Biology 2022Quote: ... and a gene-edited iPSC homozygous MYBPC3 knock-out (MYBPC3 (-/-)) (Supplemental Table 1).(15–17) iPSCs were verified to be free of mycoplasma contamination using MycoAlert Detection Kit (Lonza). Newly generated lines were karyotyped (WiCell Institute ...
-
bioRxiv - Synthetic Biology 2022Quote: ... T cells were resuspended in P3 buffer (0.75-1 x 106 cells per 18 μl P3) from the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). 10 μg/μl Alt-R S.p ...
-
bioRxiv - Cell Biology 2022Quote: ... Two million of MNCs were transfected with 10 μg of plasmid (5:1 ratio pEB-C5:pEBTg) as instructed by the Lonza CD34+ nucleofector kit (VPA-1003, Lonza) and Amaxa nucleofector (program T-016 ...
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 × 106 OSCs were transfected with 4 μg of pPB-TRE3G-FLAG-Rhino-Tjen-trTA-P2A-BlastR and 1 μg of pHsp70-Myc-hyPBase using Nucleofector Kit V (Lonza). After incubation in media containing blasticidin (50 μg/mL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Supernatant was removed and cells were resuspended in P3 Primary Cell Nucleofector® Solution with Supplement 1 (Lonza, V4XP-3032) at 5-15 million cell/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Immunology 2024Quote: Ten micrograms of expression plasmid or 20 pmol of siRNA were introduced into 1 x 107 BMDC cells by electroporation using a Nucleofector 2b (Lonza) with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza) ...
-
bioRxiv - Immunology 2023Quote: ... CTLs derived from LifeAct-GFP expressing pmel-1 mice were incubated with peptide-loaded and IFNγ-treated B16 cells cultured in phenol red-free DMEM (Lonza) supplemented with 10% FBS on stage at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 2005) using Amaxa Basic Parasite Nucleofector Solution 1 using the X-001 program of an Amaxa Nucleofector II (Lonza, Switzerland). Clones were selected by growth in medium containing phleomycin (2.5 μg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: Larvae were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate salt (Tricane, (E10521, Ethyl 3-aminobenzoate methanesulfonate) and mounted in 1% low melting point agarose (50100, Lonza) in a 60 mm x 15 mm petri dish ...
-
bioRxiv - Cancer Biology 2023Quote: Cell and organoid lines were generated from C3-TAg tumors (supplementary file 1) and tested for mycoplasma (Lonza, LT07-703) prior to use and the creation of frozen stocks ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...