Labshake search
Citations for Lonza :
951 - 1000 of 1684 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... EGM-2 was then added to each well along with 200µl of normal human lung fibroblasts (CC2512, Lonza) at a concentration of 2×105 cells/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... at a density of 2 million cells/mL in serum-free cell culture medium (Lonza AG, Basel, Switzerland) supplemented with 0.5 μg/mL FMS-like tyrosine kinase-3 (Peprotech ...
-
bioRxiv - Cell Biology 2024Quote: ... These cells are mantained in 30% FBS/1% antibiotic/antimycotic /1% Non-essential AA/ EGM-2 media (Lonza) with Laminin521 coating (5 μg/ml ...
-
bioRxiv - Microbiology 2024Quote: ... Agarose pads were prepared by pipetting 550 µL of M8T with 2% molten agarose (Lonza, Cat. no. 50081) into each quadrant of a 4-chamber glass-bottom dish (Cellvis ...
-
bioRxiv - Molecular Biology 2023Quote: ... ∼2-4 million cells were electroporated using the T-020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Genomics 2023Quote: 2 × 105 HCT116-Cas9 and iPSC-iCas9 were resuspended in 20 µl SE cell line nucleofection solution (Lonza) (HCT116-Cas9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with a blue fluorescent protein (BFP)-tag were cultured in smooth muscle cell growth medium-2 (SMGM2) (Lonza). Human umbilical cord vein endothelial cells (HUVEC ...
-
bioRxiv - Biochemistry 2023Quote: ... Briefly, D.mel-2 cells (CRL-1963, ATCC) were grown at 25°C in Insect-Xpress medium (181562, Lonza) supplemented with 1% Pen/Strep (15140122 ...
-
bioRxiv - Bioengineering 2023Quote: ... were cultured using the EGM™-2 MV Microvascular Endothelial Cell Growth Medium BulletKit™ (Lonza, CC-3202), which contains hydrocortisone ...
-
bioRxiv - Genetics 2023Quote: ... 2−106 lymphoblastoid cells were suspended in 100 μL of Nucleofector C solution (VCA-1004, Lonza Cologne AG) with 0.6 μM RNAi and transfected with the Z-001 program according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: Human aortic endothelial cells (ATCC, Manassas, VA) were cultured in EGM-2 culture media (Lonza Walkersville, Basel, Switzerland) on 0.1% gelatin-coated plastic dishes until ∼80% confluence ...
-
bioRxiv - Cell Biology 2023Quote: ... All cells were used at passage 1-2 and were growth arrested in smooth muscle basal media (Lonza) supplemented with 0.3% FBS for 24-48 h before beginning experiments ...
-
bioRxiv - Genetics 2023Quote: VSMCs were cultured in SmGM-2 medium supplemented with SMBM growth factors (Lonza, CC-4149 and CC-3181) in gelatin-coated dishes and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2024Quote: ... We add 2-ml per well of the secondary overlay containing 1.5% Sekam ME Agarose (Lonza, Cat. # 50011), 2X EMEM (Quality Biological ...
-
bioRxiv - Bioengineering 2024Quote: ... The endothelial cells and fibroblasts were cultured in microvascular endothelial cell growth medium (MVECPRO2: Lonza EGM-2 MV) and fibroblast media (Stromal cells/fibroblasts ...
-
bioRxiv - Bioengineering 2024Quote: ... were co-transfected with 2 µg plasmid-expressing guide RNA using a stem cell nucleofector kit (Lonza, Amaxa). Multiple guide RNAs were used to generate a collection of isogenic mutant cell lines ...
-
bioRxiv - Biochemistry 2024Quote: ... The mixture of non-essential amino acids (NEAA, 100X) was purchased from Lonza (Basel, Switzerland). For mammalian cell culture ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Cell Biology 2020Quote: ... The adipogenic potential was assessed after 14 days of exposure to induction media by Oil Red O staining to observe lipid droplets and AdipoRed™ assay (Lonza).
-
bioRxiv - Microbiology 2023Quote: ... 6 mmol/L l-glutamine (Lonza®), and a mixture of penicillin/streptomycin (100U/100 μg/mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were resuspended in RDM to OD600 ≈ 0.003 and sparsely spread onto an agarose pad prepared with RDM and 2% agarose (SeaPlaque GTG Agarose, Lonza). The sample was placed on the microscope with a cage incubator maintaining temperature at 37 ± 2 °C ...
-
bioRxiv - Genomics 2020Quote: ... 1 million U2OS cells were transfected using the Nucleofector 2b with 2 μg Plasmid DNA using kit V (Lonza) according the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: ... 2 × 105 organoid single cells were re-suspended with Lonza P3 nucleofection buffer and 1 µl of pmaxGFP (Lonza) and transferred to 20 µl nucleofection cuvette (V4XP-3024 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2×105 dissociated neurons were transfected with Lonza Nucleofector using the Basic Neuron SCN Nucleofector kit (Lonza, Basel, Switzerland). Transfected neurons were incubated for indicating days and processed for subsequent analyses.
-
bioRxiv - Cancer Biology 2020Quote: ... E4ORF1-transduced primary human umbilical vein endothelial cells (HUVECs) were cultured using the EGM-2 Bullet Kit (Lonza, Germany). All cell lines were kept at 37°C and 5% CO2 in a fully humidified incubator and negatively tested for mycoplasma by PCR.
-
bioRxiv - Microbiology 2021Quote: CHO cells stably expressing recombinant RBD of SARS-CoV-2 Spike (aa. 319-591) (GenBank accession no. AAP13567.1) were propagated in ProCho5 media (Lonza) containing glutamine ...
-
bioRxiv - Cell Biology 2021Quote: Vero cells were transfected with 2 µg plasmid DNA in the Amaxa Nucleofector solution R (Lonza Bioscience, Rockville, MD), following the manufacturer’s instructions with program V-01 ...
-
Dynamic chromatin organization and regulatory interactions in human endothelial cell differentiationbioRxiv - Developmental Biology 2022Quote: ... and re-seeded onto 0.2% gelatin-coated 10-cm dishes with 5.0 × 105 cells per dish in Endothelial Cell Growth Medium (EGM; Lonza) containing 20 ng/mL VEGF ...
-
bioRxiv - Immunology 2020Quote: ... Colons were incubated 2 times at 200 rpm in 40 mL HBSS + 0.1% BSA + 1% Penicillin-Streptomycin (PS, Lonza) + 5mM EDTA (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... expressing Cas9 and single sgRNAs targeting upstream and downstream regions of the lncRNA promoter/locus were co-transfected into 1.5 × 106 H1 hESCs using the Human Stem Cell Nucleofector Kit 2 (Lonza) and the Amaxa Nucleofector II (Lonza) ...
-
bioRxiv - Microbiology 2021Quote: ... 2x overlay media was added to the inoculum to give a final concentration of 2% (v/v) FBS / MEM media and 0.4% (w/v) SeaPrep Agarose (Lonza) to achieve a semi-solid overlay ...
-
bioRxiv - Cancer Biology 2020Quote: ... ON-TARGETplus non-targeting siRNA#2) were used for transient RNA interference experiments and transfected using Nucleofector technology (Lonza).
-
bioRxiv - Genetics 2020Quote: ... 20 µg ssODNs and 4 µg pSpCas9(BB)-2A-GFP construct using Human Stem Cell Nucleofector Kit 2 (Lonza). For the generation of UE-RASGEF1A-int1-KO and PIK3C2B-int10-KO hPSC lines ...
-
bioRxiv - Immunology 2021Quote: ... 2×106 cells were nucleofected with 2μg of pcDNA3.1+ plasmid per reaction (Lonza-AMAXA program X-001, Nucleofector 2b). 24 hours after transfection ...
-
bioRxiv - Immunology 2021Quote: ... washed in PBS by centrifugation for 5 min at 1300 rpm at 4°C and resuspended at 4.0 × 106 cells/ml in complete medium (IMDM 2 mM glutamax I supplemented with 8% heat-inactivated FCS (Lonza), 2% heat-inactivated chicken serum ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting vector was used to generate a D.mel-2 stable cell line adapted to grow in suspension in serum-free Insect-Xpress medium (Lonza). In brief ...
-
bioRxiv - Bioengineering 2022Quote: ... embryos were anesthetized by 30 mg/L tricaine-S (Western Chemical) and mounted in 2% low melting agarose (LONZA) for dorsal or lateral view in 35 mm Petri dishes with a glass bottom ...
-
bioRxiv - Microbiology 2022Quote: ... and neonatal dermal microvascular endothelial cells (hDMVEC) were maintained as monolayer cultures in EBM-2 medium (Lonza, Walkersville, USA) supplemented with 5% fetal bovine serum ...
-
bioRxiv - Immunology 2022Quote: ... 2.4 μl CRISPR guide RNA (gRNA; key resource table) (100 μM) and 2 μl Cas9-NLS (80 μM) (Lonza) were mixed and incubated for 40 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... HLFs were seeded in four wells of a 24-well plate in antibiotic free medium containing 2 % (Lonza, PromoCell) or 10 % (DZL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Umbilical Vein Endothelial Cells (HUVECs) were cultured in complete EGM-2 (cat# CC-3162, Lonza, Allendale, NJ, USA) and were not used beyond passage five for any experiments.
-
bioRxiv - Bioengineering 2024Quote: ... HeLa cells (2×105 cells/condition) were electroporated using the SE Cell Line 96-well Nucleofector™ Kit (Lonza) and the EH-100 pulse code (Nucleofector 4D ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μg of assembled pGL3 plasmid were electroporated into 2.5×105 AIC-H9-hESCs 35 by 4D-Nucleofector (Lonza) using P3 Primary Cell 4D-Nucleofector X kit (Lonza) ...
-
bioRxiv - Cancer Biology 2023Quote: SK-N-BE (2) (ATCC: no. CRL-2271) cells were cultured in Dulbecco’s Modified Eagle Medium (Lonza, Cat# BW12614F), supplemented with heat-inactivated FBS (Hyclone ...
-
bioRxiv - Genetics 2023Quote: ... IMR90 fetal lung fibroblasts at passage 7 were cultured in FGM-2 lung fibroblast basal media (Lonza, #CC-3131) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... one plate was prepared with 100 µl IMDM/Glutamax/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines were authenticated by Brca1/2-specific PCR-based genotyping (mouse)7,8 and they were regularly tested for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Bioengineering 2023Quote: ... cAP-0001GFP) were cultured in 0.2% gelatin-coated T75 tissue culture flasks with EGM-2 medium (Lonza, CC-3162). The medium was changed every other day ...
-
bioRxiv - Bioengineering 2024Quote: ... were seeded at 1 ×104 cells/cm2 over 0.5 cm2 sections of prosthesis held down by a PDMS ring inside 24-well plates with 1.5 mL of endothelial cell growth medium-2 (Lonza). After 2 h of adhesion ...