Labshake search
Citations for Lonza :
851 - 900 of 1684 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Initiation of differentiation was done with Preadipocyte Differentiation Media (PDM-2) (Lonza, Cat: #PT-8002). Maintenance of differentiation was done with DMEM supplemented with 1.9 ng/mL Insulin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... were maintained and cultured in smooth muscle basal media (SmGM-2 BulletKit; CC-3182; Lonza). The media was supplemented with hEGF ...
-
bioRxiv - Cancer Biology 2023Quote: All cultures were routinely (every 1-2 months) tested for mycoplasma contamination using MycoAlert (Lonza). Autosomal STR profiles for cell line authentication were performed by the University of Arizona Genetics Core.
-
bioRxiv - Bioengineering 2023Quote: ... HUVECs were maintained in EBM-2 MV BulletKit medium (CC-3156 and CC-4147; Lonza). HUVECs in passages 3-5 were used for all experiments.
-
bioRxiv - Bioengineering 2022Quote: ... Adipocyte spheroids were formed by culturing spheroids in pre-adipocyte differentiation medium (PDM-2, Lonza) containing 1% insulin ...
-
bioRxiv - Bioengineering 2023Quote: ... Human umbilical vein endothelial cells (HUVECs) were expanded in Endothelial Cell Growth Medium-2 (Lonza), harvested for use between passage P4- P6 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary BMECs derived from healthy bone marrow specimens were cultured in EBM-2 media (Lonza) supplemented with necessary cytokines (Lonza).
-
bioRxiv - Microbiology 2024Quote: ... were electroporated with 2 μg plasmid using pulse code FF-120 (Lonza Amaxa 4D Nucleofector). Cells were incubated for 10 minutes at room temperatue ...
-
bioRxiv - Developmental Biology 2024Quote: ... were cultured in fibroblast growth media supplemented with FGM-2 bullet kit (Lonza, CC-3132) All cells were maintained at 37°C and 5% CO2 ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured using EBMTM-2 Endothelial Cell Growth Basal Medium (Lonza Bioscience, Cat. # CC- 3156) supplemented with the EGMTM-2 Endothelial SingleQuotsTM Kit (Lonza Bioscience ...
-
bioRxiv - Microbiology 2024Quote: ... All endothelial cells were grown in Endothelial Growth Medium-2 BulletKitTM medium (EGM2) from Lonza and maintained at low passages as previously described.9 Normal human astrocytes (NHA ...
-
bioRxiv - Cell Biology 2024Quote: ... ASC52telo cells were cultivated in Endothelial Cell Growth Medium-2 (Lonza, Cat. no. CC-3162) supplemented with 4% FBS (Merck KGaA ...
-
bioRxiv - Bioengineering 2024Quote: ... were purchased at Passage 2 and cultured in mesenchymal stem cell basal medium (Lonza, CA) with mesenchymal cell growth supplement ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1% penicillin and streptomycin (P/S, Cat. #17-602E; Lonza), 1% L-glutamine (Cat ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Transfection into hippocampal neurons was performed using the AMAXA nucleofector system (Lit, VPG-1003; Program: O-003; Lonza) before plating the dissociated hippocampal cells onto coverslips (0 days in vitro [DIV]) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% non-essential amino acids and 10% fetal bovine serum (Lonza, NJ, USA). The media for ER+ cell lines were further supplemented with insulin (0.1 µg/ml) ...
-
bioRxiv - Cell Biology 2020Quote: ... which were maintained using FGM-2 culture medium and protocols provided by the manufacturer (Lonza Inc.). For visualization purposes ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were detached using TrypLE Express and co-cultured in EGM-2 media (Lonza# CC-3162) in different combinations for additional 60 hours as described in Supplemental Figure 8A-H.
-
bioRxiv - Genomics 2020Quote: ... S2 cells were seeded at 2×106 per 6cm plate in 4 mL S2 medium (Lonza). One hour after plating ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary human skeletal muscle myoblasts (HSMMs) were cultured in growth medium (SkGM-2 Bullet Kit, Lonza). HEK293T cells (kindly gifted by Slimane Ait-Si-Ali lab ...
-
bioRxiv - Cell Biology 2020Quote: Live cells plated on glass coverslips were fixed with 2% paraformaldehyde (Acros Organic) in PBS (Lonza) for 20 minutes at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... NIH) in 100 µl IMDM/Glutamax/10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Bioengineering 2020Quote: ... ECs were suspended in EGM™-2 Endothelial Cell Growth Medium (Lonza,Basel, Switzerland CC-3162). Cells were cultured on 10 % matrigel coated microchannels and maintained in a humidified CO2 incubator at 37 °C and 5% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) on a 24 × 55-mm coverslip (Matsunami) ...
-
bioRxiv - Cell Biology 2021Quote: ... Young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) prepared on a 24 × 55-mm coverslip (Matsunami) ...
-
bioRxiv - Cell Biology 2021Quote: ... LECs were cultured using the EGM2-Endothelial cell growth medium-2 bullet kit (Lonza, Basel, Switzerland). Cells up to 6 passages were used in in vitro experiments ...
-
bioRxiv - Molecular Biology 2021Quote: ... at a confluence of 80-90% were incubated for 24 hours with EBM-2 medium (Lonza) containing 1% FBS (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... Endothelial cells (104 cells/well) were treated with compounds in fully supplemented EGM-2 medium (LONZA) for 48 h and then analyzed as above.
-
bioRxiv - Bioengineering 2022Quote: ... as described before.[29] They were cultured in EBM™-2 basal medium (LONZA, CC-3156) that was supplemented with EGM™-2 SingleQuots™ supplements (LONZA ...
-
bioRxiv - Biophysics 2023Quote: The pellet of cells after electroporation was mixed with 2 % (w/w) SeaPrep agarose (Lonza, Switzerland) in DMEM at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... an electroporation reaction consisted of 2 × 105 HEK293T cells in 20 μL of SF buffer (Lonza) and 2 μL of 20 μM Cas9 RNP (equivalent to 40 pmol final concentration) ...
-
bioRxiv - Immunology 2024Quote: ... NIH) in 100 µL IMDM GlutaMAX/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/mL human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were treated with various concentrations of BMP-2 or FK506 in an osteogenic media (Lonza). Cell culture medium was changed every 3 days ...
-
bioRxiv - Bioengineering 2024Quote: ... they were treated with various concentrations of BMP-2 or FK506 in an osteogenic media (Lonza). The medium was replaced every 3-4 days ...
-
bioRxiv - Neuroscience 2023Quote: ... and the cell pellet resuspended in 2 ml of ACK lysing buffer (Lonza, Cat# 10-548E). After centrifugation ...
-
bioRxiv - Immunology 2023Quote: ... 2 samples of 5x106 PBMCs were nucleofected in 100 mL of P3 buffer (Lonza; V4XP-3024) with 125 pmol of Alt-R Sp HiFi Cas 9 nuclease v3 (IDT ...
-
bioRxiv - Bioengineering 2023Quote: ... 2×109 Freestyle CHO-S cells were resuspended in 500ml ProCHO 4 Protein-free Medium (Lonza, Cat#BEBP12-029 ...
-
bioRxiv - Cell Biology 2023Quote: ... then the medium was replaced with hLSEC medium [EGM-2-MV microvascular endothelial cell medium (Lonza) supplemented with 50ng/mL recombinant human vascular endothelial growth factor-A (VEGF-A ...
-
bioRxiv - Immunology 2023Quote: ... with 0.05 mL blocking buffer (98% v/v FACS buffer (PBS + 2% v/v dFBS (Lonza)) and 2% v/v Fc receptor binding inhibitor (Thermo Fisher Scientific)) ...
-
bioRxiv - Immunology 2023Quote: ... NIH) in 100 µl IMDM/Glutamax/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were embedded in a YEA medium solidified with 2% low melting temperature agarose (Lonza, #50101) on a polylysine-coated glass bottom dish (Matsunami ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured for a maximum of 4 passages cultured in EGM™-2 (Lonza #CC-4176) in T-175 or T-75 culture flasks (Thermo ...
-
bioRxiv - Biophysics 2024Quote: ... Young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) prepared on a 24 × 55-mm coverslip (Matsunami Glass ...
-
bioRxiv - Bioengineering 2024Quote: ... which directly correlates to cellular metabolic activity.58 LSEC cells were maintained in EBM-2 (Lonza) media with EGM-2 BulletKit (Lonza) ...
-
bioRxiv - Microbiology 2024Quote: Human colorectal adenocarcinoma cell line Caco-2 were maintained in Dulbecco’s Modified Eagle’s Media (DMEM) (Lonza) and supplemented with 10% FCS (Fetal calf serum ...
-
bioRxiv - Biochemistry 2024Quote: Human neuron cortical cells (HCN-2, ATCC, CRL-3592) were cultured in DMEM (Lonza, BE12-604F) supplemented with 4 mM L-glutamine (Biological Ind. ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...