Labshake search
Citations for Lonza :
801 - 850 of 1684 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: Passage 2 primary human bone marrow derived MSC (PT-2501) were purchased from Lonza for all the experiments ...
-
bioRxiv - Biophysics 2022Quote: ... SAOS-2 cells were transfected using the SF buffer (Lonza, Cologne, Ger, V4XC-2012) and pulse code ‘DS-150’ ...
-
bioRxiv - Immunology 2022Quote: ... for 4 days with complete EGM-2 media (Lonza CC-4147, Lonza CC-3156). Upon reaching 80-90% confluence ...
-
bioRxiv - Immunology 2022Quote: ... for 4 days with complete EGM-2 media (Lonza CC-4147, Lonza CC-3156). Upon reaching 80-90% confluence ...
-
bioRxiv - Cell Biology 2024Quote: Human telomerase corneal epithelial (hTCEpi) cells 47 were cultured in KGM-2 media (Lonza) without antibiotics ...
-
bioRxiv - Bioengineering 2023Quote: ... hECFCs were cultured according to manufacturer’s instructions in endothelial growth medium 2 (EGM2, Lonza) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2022Quote: ... We used the Human Stem Cell Nucleofector Kit 2 (Lonza, catalog no. LONVPH-5022). After electroporation ...
-
bioRxiv - Immunology 2023Quote: HUVECs were maintained in EBM-2 culture media according to the manufacturer’s instructions (Lonza). NF-κB signalling and cytokine release assays have been described previously [21] ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were first cultured for initial proliferation in growth medium (SmGM- 2, Lonza). Then ...
-
bioRxiv - Microbiology 2022Quote: ... were obtained from Lonza (Cat# CC-2527) and cultured with EGM-2-MV medium (Lonza, Cat# CC-3202). For preparation of the airway-on-a-chip ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were washed with PBS and replaced with SkGM-2 BulletKit growth medium (Lonza) containing quercetin dissolved in DMSO at the indicated concentrations for 72 hours under standard culture conditions ...
-
bioRxiv - Microbiology 2022Quote: ... were obtained from Lonza (Cat# CC-2527) and cultured with EGM-2-MV medium (Lonza, Cat# CC-3202). For preparation of the airway-on-a-chip ...
-
bioRxiv - Immunology 2023Quote: ... Expanded Treg cells (2 × 106) were resuspended into P4 Primary Cell solution (Lonza Bioscience) and nucleofected with Cas9 protein and gRNAs ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 × 105 cells were resuspended in 17 μL of P3-supplemented nucleofection buffer (Lonza). We then added RNP mix ...
-
bioRxiv - Microbiology 2023Quote: ... were obtained from Lonza (Cat# CC-2527) and cultured with EGM-2-MV medium (Lonza, Cat# CC-3202). For preparation of the airway-on-a-chip ...
-
bioRxiv - Cell Biology 2023Quote: HUVECs were grown on 1% gelatin-coated plates in EGM-2 medium (Lonza: CC3156) for 48 hrs ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 15% fetal bovine serum and 2 mM L-glutamine (Lonza, BE17-605E).
-
bioRxiv - Microbiology 2023Quote: ... were obtained from Lonza (Cat# CC-2527) and cultured with EGM-2-MV medium (Lonza, Cat# CC-3202). For preparation of the airway-on-a-chip ...
-
bioRxiv - Bioengineering 2023Quote: Freestyle CHO-S cells were purchased from Thermo Scientific (Cat#R80007) and were expanded in PowerCHO 2 Serum-free Medium (Lonza BELN12-771Q) supplemented with GlutaMAX (Gibco) ...
-
bioRxiv - Physiology 2023Quote: ... ciCMVEC were cultured in endothelial growth medium 2 microvascular (EGM2-MV; Lonza, Basel, Switzerland) containing 5% fetal calf serum but without vascular endothelial growth factor A or Gentamicin Sulfate-Amphotericin.
-
bioRxiv - Neuroscience 2023Quote: ... were cultured in an endothelial growth medium bullet kit (EGM- 2; Lonza, Basel, Switzerland) and used for experiments between passages three and seven ...
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... Cells were cultured in Endothelial Cell Growth Basal Medium-2 (EBM2) (Lonza, Basel, Switzerland) with 10% heat inactivated fetal bovine serum ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were re-plated in Skeletal Muscle Growth Medium-2 (Cat# CC-3245, Lonza) for expansion ...
-
bioRxiv - Cell Biology 2024Quote: Human umbilical vein endothelial cells (HUVECs) were cultured in EBM-2 (Lonza CC-3156) media supplemented with EGM-2 SingleQuots Supplements (Lonza CC-4176 ...
-
bioRxiv - Physiology 2024Quote: ... were obtained from PromoCell and grown in EGM-2MV (microvascular endothelial cell growth medium-2) medium from Lonza Bioscience as previously described (3) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and hFOB 1.19 (ATCC CRL-11372TM) were cultured in EBM-2 (Lonza #CC-3162) supplemented with EGM™ SingleQuots (Lonza #CC-4176) ...
-
bioRxiv - Genomics 2024Quote: ... were cultured in endothelial basal medium (EBM-2) with supplements (Lonza, cat. #CC-3162). Low passage number cells were seeded in 18-well μ-slides (Ibidi) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 µg of DNA were run on 0.75% agarose (Seakem ME Agarose, Lonza), dried under vacuum for 2 h at 50°C ...
-
bioRxiv - Developmental Biology 2024Quote: HUVECs were purchased from Lonza and cultured on gelatin-coated tissue culture dishes with EGM-2 culture medium (Lonza). Cells were used between passages 3 and 5 for experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary uveal melanoma cells were equally divided onto two wells of a fibronectin-covered 6-well tissue culture plate and grown in 5% CO2 in MDMF medium which consists of HAM’s F12 (Lonza, Walkersville MD, USA) supplemented with 1 mg/mL BSA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Bioengineering 2024Quote: ... 1x MEM Non-Essential Amino Acids Solution (MEMNEAA) (Lonza, Cat no. 11140050), 1x GlutaMAX Supplement (Gibco ...
-
bioRxiv - Cancer Biology 2021Quote: ... batch 0000440546 and 0000442486) and cultured in EBMTM-2 Basal Medium (Lonza, Walkersville, MD, USA) with EGM-2MV Single Quots (Lonza ...
-
bioRxiv - Developmental Biology 2022Quote: ... myogenic progenitors were resuspended in skeletal muscle growth medium (SKGM-2, Lonza, Cat. CC-3245) with 10 µM ROCK inhibitor ...
-
bioRxiv - Genetics 2020Quote: ... 250 ng of plasmid per 2 × 105 cells was transfected using Amaxa solution SF (Lonza) and program CA-138 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2×106 fibroblasts were harvested and used in each transfection with a Nucleofector device (Lonza) according to the manufacturer’s protocol using the program T-20 and the Amaxa kit R (Lonza) ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM L-Glu (Lonza, #17-602E, 100 U/ml Pen/Strep (Lonza, #17-602E), 10 mM HEPES (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human umbilical vein endothelial cells (HUVECs) prescreened for angiogenesis were cultured in EGM-2 (Lonza). Breast cancer cells were cultured in MammoCult (Stemcell Technologies ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells (ATCC CCL-2) were grown in DMEM with glucose and L-glutamine (Lonza), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... K562 cells (2×105 cells/transfection) were transfected with an Amaxa 4D-nucleofector™ (Lonza) using the SF nucleofection kit (program FF-120 ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were cultured in endothelial cell growth medium (EGM-2 CC-3162, Lonza, Basel, Switzerland), supplemented with BulletKit (CC-4176 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human umbilical vein endothelial cells (HUVEC) cultured in endothelial growth medium (EGM-2, Lonza, UK) for fewer than 5 passages were used in all experiments ...
-
Measuring adaptation dynamics to hydrogen peroxide in single human cells using fluorescent reportersbioRxiv - Cell Biology 2020Quote: ... 1% L-glutamine (2 mM) and 1% (v/v) penicillin-streptomycin (100 IU/ml) (Lonza). Cell cultures are maintained at 37°C in a humidified atmosphere containing 5 % CO2 (v/v) ...
-
bioRxiv - Genomics 2020Quote: ... or 2×103 cells per well of a 96-well culture plate in DMEM (Lonza) supplemented with 10% (v/v ...
-
bioRxiv - Bioengineering 2020Quote: ... 2% (w/v) L-glutamine and 0.1% (w/v) Gentamicin-Amphotericin (#PT-3001; Lonza, Germany) with 5% CO2 in air at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... (304-05a) were cultured in endothelial basal medium (EBM)-2 (LONZA Clonetics™ CC-3156) with 5% fetal bovine serum (GIBCO) ...
-
bioRxiv - Cell Biology 2020Quote: ... HK-2 cells were nucleofected using Mirus nucleofection solution and T20 program of nucleofector (Lonza).
-
bioRxiv - Cell Biology 2020Quote: ... cells were fed every 2 days with cardiac fibroblast basal media (CFBM) (Lonza, CC-3131) supplemented with 75ng/mL bFGF ...
-
bioRxiv - Microbiology 2020Quote: Human intestinal epithelial Caco-2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Lonza), supplemented with 0.5% penicillin-streptomycin (50 μg/mL-50 μg/mL ...