Labshake search
Citations for Lonza :
751 - 800 of 897 citations for Carboxypeptidase Y from Baker's Yeast since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... were derived by isolation of Lin-BM HSPCs from double mutant mice and were cultured in X-Vivo medium (Lonza) in the presence of 10 ng/mL mIL-3 ...
-
bioRxiv - Molecular Biology 2022Quote: Human primary pulmonary artery endothelial cells (HPAEC) were purchased from ATCC (ATCC) and maintained in endothelial cell growth medium-2 (EGM-2, Lonza) supplemented with EGM-2 SingleQuot Kit (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... was used to enrich in CD4+ or CD8+ T cells from PBMCs that were cultured in X-vivo 15 media (Lonza) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2020Quote: Adipose-derived human mesenchymal stem cells (AD-hMSCs) and dermal fibroblasts (DF) used in this study were purchased from Lonza. AD-hMSCs and DF were isolated from a 42-year-old ...
-
bioRxiv - Cell Biology 2020Quote: Human aortic endothelial cells (HAEC, CC-2535) and human skeletal myoblasts (HSMM-Muscle Myoblasts, CC-2580) were obtained from Lonza Company ...
-
bioRxiv - Genetics 2021Quote: ... Cas9-sgRNA-Thy1.1 plasmid transfection was carried out by electroporation using Mouse Embryonic Stem Cell Nucleofector™ Kit from Lonza. After 36 hours of transfection Thy1.1 expressing cells were FACS sorted and sparsely seeded for clonal expansion on 15cm plate ...
-
bioRxiv - Cell Biology 2021Quote: ... were isolated from healthy donors (n=3) as described[4] and seeded on 6 cm dishes within BEGM media (Lonza) before transduction with lentivirus (empty vector (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... HeLa (ATCC® CCL-2™), and HaCaT cells (gift from Jonathan Garlick, Tufts University) were grown in Dulbecco’s modified Eagle medium (DMEM; Lonza) containing high glucose ...
-
bioRxiv - Cancer Biology 2021Quote: Human A549 lung adenocarcinoma cells obtained from ATCC (Manassas VA) were grown in Dulbecco’s Modified Eagle’s Medium (DMEM – Lonza, Wakersville MD) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cancer Biology 2020Quote: ... murine 3B11 and human HUVECs endothelial cells (all purchased from ATCC) were cultured in RPMI 1640+ 10% Fetal Bovine Serum (FBS) or in endothelial grown media (EGM-2-Lonza).
-
bioRxiv - Genomics 2020Quote: Primary human dermal LECs and BECs were isolated from neonatal human foreskin as described previously88 and cultured in endothelial basal medium (EBM, Lonza) supplemented with 20% FBS ...
-
bioRxiv - Microbiology 2021Quote: Vero E6 cells (C1008; green African monkey kidney cells) were obtained from Public Health England and cultured in DMEM medium (Lonza) supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Genomics 2020Quote: ... bulk PBMCs obtained from healthy donors were thawed and cultured in a T-cell growth media (TCGM) consisting of X-VIVO15 (Lonza) supplemented with 5% human serum ...
-
bioRxiv - Immunology 2021Quote: A single-cell suspension was prepared from spleen and lymph nodes and red blood cells were removed by lysis with ACK buffer (Lonza). CD4+ T cells were enriched using microbeads (Miltenyi Biotec ...
-
bioRxiv - Immunology 2020Quote: ... or media were cultured in 96 well flat bottom plates overnight then PBMC (2×105) from healthy donors were cultured at 37 °C in X-VIVO 15 media (Lonza) with 50-200 U/mL IL-2 (Peprotech) ...
-
bioRxiv - Molecular Biology 2021Quote: ... human endothelial colony-forming cell-derived endothelial cells (ECFC-EC) are isolated from cord blood via selection for the CD31+ cell population and cultured in EGM2 medium (Lonza). Normal human lung fibroblasts (LF ...
-
bioRxiv - Immunology 2021Quote: Spleens and cervical lymph nodes were isolated from 6-10 weeks old C57B6 mice and homogenized through a sieve in B cell culture medium (RPMI-1640 (Lonza), 10% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2020Quote: ... Endotoxin concentrations ranged from 150-175 EU/mL as determined using the limulus amebocyte lysate assay (Lonza, Walkersville, MD, USA). This concentration of ODE has been previously shown to produce optimal experimental effects and is well-tolerated in mice (11 ...
-
bioRxiv - Immunology 2021Quote: ... the vector backbone used for generation of this plasmid is a kind gift from Ulrich Wissenbach (Saarland University) who previously modified the AMAXA vector (Lonza) by replacing the sequence encoding GFP with a linker sequence encoding a multiple cloning site (pMAX) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cas9-RNP was complexed for 15 minutes at 37°C and transferred to a single well of a 96-well strip nucleofection cuvette from Lonza for use with the Nucleofector 4D ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary prostate cells established from fresh male radical prostatectomy tissues were isolated as previously described and cultured in prostate cell growth medium (Lonza). All cells were cultured at 37°C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... MCF10A cells were purchased from ATCC and cultured with MEGM™ Mammary Epithelial Cell Growth Medium BulletKit™ (Lonza/Clonetics) supplemented with not supplemented with 100 ng/ml cholera toxin (Millipore) ...
-
bioRxiv - Bioengineering 2022Quote: ... 90 μL of nucleofection solution (16.2 μL of Supplement solution mixed with 73.8 μL of SF solution from SF Cell Line 4D-Nucleofector™ X Kit L) (Lonza) was mixed thoroughly with the cell pellet ...
-
bioRxiv - Immunology 2022Quote: ... we used SF Cell Line 4D-Nucleofector™ X Kit L (for Raw 264.7 cells) or SG Cell Line 4D-NucleofectorTM X Kit L (for NIH/3T3 cells; both from Lonza Inc.). Up to 5 × 106 cells were resuspended in 100 μl of nucleofection solution ...
-
bioRxiv - Microbiology 2022Quote: ... Both HPMEC and HUVEC cell lines were propagated (passages 5–10) and maintained in endothelial growth medium 2 (EGM-2) using the EGM-2 bullet kit from Lonza following the manufacturer’s specifications and grown in a CO2 incubator at 37°C with 5% CO2.
-
bioRxiv - Molecular Biology 2022Quote: ... D-PBS was gently aspirated from the T cell pellet and then resuspended in 15 μL of buffer P3 (Lonza). The cell suspension was then transferred to the RNP mix and thoroughly triturated ...
-
bioRxiv - Immunology 2022Quote: ... was performed by nucleofection of primary cDCs isolated from HD with specific siRNAs (SMART-pool, Horizon Discovery) or irrelevant scramble siRNA in an Amaxa4D-Nucleofector (Lonza) instrument using the CM120 protocol and following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... T cells were resuspended in P3 buffer (0.75-1 x 106 cells per 18 μl P3) from the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). 10 μg/μl Alt-R S.p ...
-
bioRxiv - Molecular Biology 2022Quote: ... and one adult cell line lablled J (59 year old, Caucasian female, catalogue number: CC-2511, lot number: #693503) purchased from Lonza.
-
bioRxiv - Molecular Biology 2022Quote: Primary human fibroblasts were obtained from ATCC (PCS-201-013) and grown in Dulbecco’s modified Eagle Medium (DMEM) (Biowhittaker® Reagents, Lonza) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... and irradiated allogeneic PBMC (50 Gy) pooled from three donors as feeder cells in T-cell medium RPMI 1640 plus (Lonza):AIM-V (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... MCF 10A cells were obtained from ATCC (Cat# CRL10317) and were grown in mammary epithelial growth media (Cat# CC-3150, Lonza) supplemented with cholera toxin (Cat# C8052 ...
-
bioRxiv - Cancer Biology 2024Quote: ... were isolated from 8 to 16-week-old Rptorfl/fl or Tsc2fl/fl mice and maintained in EGM-2 medium (Lonza), as previously described71–75 ...
-
bioRxiv - Immunology 2022Quote: ... Red blood cells from the collected blood or from the single cell suspension of the cardiac tissue were removed via treatment with a hypotonic lysis buffer (Lonza). Cells were then washed and the following antibodies were used for flow cytometry ...
-
bioRxiv - Cancer Biology 2023Quote: Cell and organoid lines were generated from C3-TAg tumors (supplementary file 1) and tested for mycoplasma (Lonza, LT07-703) prior to use and the creation of frozen stocks ...
-
bioRxiv - Immunology 2023Quote: ... were used to sort CD3-positive T cells from peripheral blood mononuclear cells (PBMCs) and T cells were cultured in X-vivo (Lonza) medium supplemented with 5% FBS (Gibco) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in 90 µL of nucleofection solution (16.2 µL of Supplement solution mixed with 73.8 µL of SF solution from SF Cell Line 4D-Nucleofector™ X Kit L) (Lonza), transferred to the 15 µL RNP solution ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: Ha deposition was detected staining constructs sections (n≥10 from n≥3 chambers considering two different hACs and two different MSCs donors) with OsteoImage (Lonza) as detailed above ...
-
bioRxiv - Molecular Biology 2023Quote: ... All hFRG mice reported in this study were engrafted with human and non-human primate hepatocytes from the same donors (Caucasian, 15-month-old donor, Lonza, #HUM181791 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Measured tissues originated from six F508del homozygous patients (CF patient #1: CF-AB0609, female, 31 years-old; CF patient# 3: #28388-0000450918, Lonza, male ...
-
bioRxiv - Bioengineering 2023Quote: Human umbilical vein endothelial cells large volume (HUVECs XL) and human dermal microvascular endothelial cells (HDMECs) were purchased from Lonza and cultured in EGM-2 (Lonza ...
-
bioRxiv - Genomics 2022Quote: ... cells (from two donors) were grown to 80% to 90% confluence in endothelial basal medium 2-MV with supplements (EBM; Lonza) and 5% fetal bovine serum (FBS ...
-
bioRxiv - Genetics 2023Quote: ... Samples of supernatant media from cell culture experiments were analyzed monthly for the presence of mycoplasma using MycoAlert PLUS (Lonza).
-
bioRxiv - Microbiology 2023Quote: ... purified schizonts derived from the hap2ko mCherry parasite was electroporated using the FI-115 program of the 4D nucleofector system (Lonza). Transfected schizonts were then injected intravenously into BALB/c mice ...
-
bioRxiv - Genomics 2023Quote: ... The hiPSCs were then expanded by passaging from one well onto three wells of a six-well plate using Versene (Lonza) in mTeSR1 medium containing 5 μM ROCK inhibitor ...
-
bioRxiv - Bioengineering 2023Quote: Human lung adenocarcinoma cell line A549 (#CCL-185) was purchased from American Tissue Culture Collection (ATCC) and cultured in growth medium (DMEM/F12 (Lonza) supplemented with 10% FBS (Biowest ...
-
bioRxiv - Physiology 2023Quote: Human lung microvascular ECs were purchased from ATCC and cultured in EBM-2 medium supplemented with EGM-2 BulletKit (Lonza). THP-1 and U937 cells were purchased from ATCC and cultured in RPMI medium 1640 (Corning ...
-
bioRxiv - Molecular Biology 2023Quote: ... A cell count ranging from 1 × 10^5 to 2 × 10^5 cells was collected and suspended in 15 µL of nucleofection buffer (Lonza). Electroporations were conducted in the strip format ...
-
A synthetic elastic protein as molecular prosthetic candidate to strengthen vascular wall elasticitybioRxiv - Cell Biology 2023Quote: Human Umbilical Vein Endothelial Cells (HUVEC; CC-2519) and human Aortic Smooth Muscle Cells (AoSMC, CC-2571) purchased from Lonza were cultured in EGM (CC-3124 ...