Labshake search
Citations for Lonza :
451 - 500 of 546 citations for S 3 Amino 4 4 cyanophenyl butanoic acid hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... The short pvT1 amplicons were size-separated by electrophoresis in a 3% NuSieve (Lonza, Basel, Switzerland) agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cell suspensions were mixed with ultra low melting agarose solution (3% SeaPrep®, LONZA, #50302) in a volume ratio of 1:1 and were loaded onto the two aqueous phase inlets of the FFD ...
-
bioRxiv - Immunology 2022Quote: ... The isolated splenocytes were incubated for 3 mins in red blood cell lysis with ACK (Lonza) followed by washing with media ...
-
bioRxiv - Biophysics 2020Quote: ... ∼300 pairs of ovaries were harvested from 3-6 day old females in 1X PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... Antibodies which contained endotoxin levels above 3 EU/ml (Kinetic-QCL Kinetic Chromogenic LAL Assay, Lonza) were depleted of endotoxin with the ToxinEraser Endotoxin Removal kit (GenScript ...
-
bioRxiv - Bioengineering 2024Quote: Bone marrow organoids were fabricated by seeding 3 × 103 mesenchymal stem cells (hMSC, Lonza, PT-2501) and 6 × 103 human bone marrow CD34+ cells (STEMCELL Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... The absence of Mycoplasma contamination was verified every 3 weeks with the MycoAlert detection kit (Lonza). Previously described patient-derived short-term cultures (<10) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dinucleosome-sized DNA fragments were purified and excised from a 3% NuSieve GTG agarose gel (Lonza) using the Zymoclean Gel DNA Recovery Kit (Zymo Research) ...
-
bioRxiv - Immunology 2023Quote: ... MEFs were allowed to expand for 2-3 days before harvest with 0.05% trypsin-EDTA (Lonza). iBMDMs were immortalized with J2 virus to generate iBMDMs.
-
bioRxiv - Biochemistry 2023Quote: ... Virus was concentrated using ultracentrifugation (95000 g for 3 hr) and suspended using OPTI-MEM (Lonza). Viral transfections assays were performed by plating target 293T (ACE2+ve ...
-
bioRxiv - Immunology 2024Quote: ... The bEnd.3 cells were cultured in DMEM supplemented with L-glutamine (BE17-605 F; Lonza), Na-pyruvate (S-8636 ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼300 pairs of ovaries were dissected from 3-6 day old females in 1× PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... was dissolved for at least 3 hrs at 37 °C in Dulbecco’s Phosphate-Buffered Saline (DPBS, Lonza) at twice the final concentration ...
-
bioRxiv - Immunology 2022Quote: Calu-3 cell line was obtained from ATCC and maintained in Eagle’s Minimum Essential Medium(EMEM; Lonza) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2022Quote: Calu-3 lung carcinoma cells (HTB-55; ATCC) were cultured in Eagle’s minimum essential medium (EMEM, Lonza), supplemented with 9% fetal calf serum (FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Cell Biology 2024Quote: ... and subsequently combined with 3 µl RNPs before being transferred to a 96-well electroporation plate (Lonza). Electroporation was performed using the pulse code EH115 on a 4D-Nucleofector 96-well Unit (Lonza ...
-
bioRxiv - Biochemistry 2021Quote: ∼300 pairs of ovaries per replicate were harvested from 3-6 day old females in 1X PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... All cell lines were tested for mycoplasma every 3 months using MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland). All cells used were <20 passages from thaw.
-
bioRxiv - Immunology 2021Quote: ... and suspended at a concentration of 3 × 106cells/mL in RPMI-1640 (BioWhittaker®, Lonza, Walkersville, MD, USA) containing 15% heat-inactivated horse serum ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2023Quote: Bone marrow derived DCs at day 7 (3×106) were transfected with 100μl of the Amaxa solution (Lonza) containing siRNA (control or target-specific ...
-
bioRxiv - Immunology 2023Quote: ... beads were removed on day 3 followed by electroporation using the Human T Cell Nucleofector™ Kit (Lonza) and the Amaxa Nucleofactor® 2b (Lonza ...
-
bioRxiv - Neuroscience 2022Quote: ... Electrophoresis of 10 µl of RT-PCR products was performed using 3% agarose (SeaKem LE Agarose by Lonza) with molecular ladder gel containing 0.5 µg/ml ethidium bromide in x0.5 tris-acetate-ethylenediaminetetraacetic acid (TAE ...
-
bioRxiv - Cell Biology 2023Quote: For immunoprecipitations performed on THP-1 cells were first transfected with 2 μg of empty vector pCDNA 3.1 or plasmid containing 3x FLAG_Vamp-3 using the Amaxa 4D nucleoporator system (Lonza) with the Amaxa SG Cell line kit and program FF-100 and following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were cultured less than 3 months after resuscitation and tested for contaminants using MycoAlert (Lonza) every 1-3 months to ensure they were free of Mycoplasma contamination.
-
bioRxiv - Microbiology 2024Quote: ... and sporozoites were collected by centrifugation at 2,500 rpm for 3 min and resuspended in SF buffer (Lonza) containing 50 mg of tagging plasmid or 30 mg of linear targeting template and 30 mg CRISPR/Cas9 plasmid in a total volume of 100 ml ...
-
bioRxiv - Biochemistry 2024Quote: ... 3×105 cells were electroporated using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza) with 400 ng donor DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL of the sgRNA (total 300 pmol) was added to 12 µL of SE buffer (Lonza V4XC-1032). In another well ...
-
bioRxiv - Biochemistry 2021Quote: ... For each nucleofection 3 x 106 cells were resuspended in 80 μl of mouse ES cell nucleofection solution (Lonza). Equimolar (0.32 nmol ...
-
bioRxiv - Cancer Biology 2020Quote: ... were used in passages 3-6 and cultured on 0.1% gelatin-coated tissue culture plates in complete EGM2 (Lonza) supplemented to a total of 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Bioengineering 2024Quote: ... and SK-BR-3 cells (Korean Cell Line Bank, Korea) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Lonza, Switzerland) supplemented with 10 % (v/v ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: A total of 3-4µg of plasmid DNA was electroporated into 3-4x106 early passage ES cells using the Amaxa Nucleofector II (Lonza) programme A-023 ...
-
bioRxiv - Cell Biology 2022Quote: Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
bioRxiv - Cell Biology 2022Quote: Normal human bronchial epithelial cells (HBECs) from 3 independent donors (Supplemental Table S1) were obtained from Lonza (CC-2540) and cultured in BEGM growth media (Lonza CC-3170) ...
-
bioRxiv - Biophysics 2023Quote: ... DNA samples were also analyzed by electrophoresis through 1.5 % and 3 % agarose gels (Seakem LE agarose, Lonza, Rockland, ME) in TAE (Tris-acetate + 1 mM EDTA ...
-
bioRxiv - Genetics 2024Quote: ... Approximately 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL) in nucleofector strip format (Lonza). Electroporation was performed in Unit X ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Cell Biology 2024Quote: ... NHEKs (no later than passage 3) were cultured in KGM Gold Keratinocyte Growth Medium BulletKit (00192060, Lonza, Basel, Switzerland). For daily maintenance and subculturing of NHEKs ...
-
bioRxiv - Microbiology 2020Quote: ... Infected CD4 T cells were washed with PBS and 3 million cells per condition were resuspended in 20uL buffer P2 (Lonza) with 4μM IDT electroporation enhancer ...
-
bioRxiv - Immunology 2022Quote: ... Thawed PBMCS were rested for 3-4h at 37°C in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 5% human Ab serum ...
-
bioRxiv - Neuroscience 2020Quote: ... The spinal cord was spun at 3000 rpm for 3 min at room temperature after which the embryonic medium was replaced with 1x trypsin-EDTA (Lonza). The tissue was macerated in trypsin and incubated at 37°C for 15-20 mins ...
-
bioRxiv - Microbiology 2021Quote: ... Viral supernatants were collected 3 and 6 days post-infection and induced-cell death and viral titers were determined in the ToxiLight Bioassay (Lonza) and PFA ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... 1×106 activated CD4+T cells were stimulated by IFN-γ for 24 h before being transfected with 3 siRNAs following Amaxa Nucleofector following the manufacturer’s protocols (Lonza). Two days post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested to be negative for mycoplasma every 2–3 months using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cell Biology 2022Quote: ... and diseased COPD human lung fibroblasts (DHLFs) from 3 donors (donor IDs: OF3353, OF3418 and OF3238) were purchased from Lonza and tested for their response to FGF2 and TGFβ stimulation.
-
bioRxiv - Cancer Biology 2022Quote: ... and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma) or EH100 (TILs) on a 4D Nucleofector (Lonza). Melanoma cells were immediately recovered in full melanoma media in 12-well plates ...