Labshake search
Citations for PerkinElmer :
401 - 450 of 755 citations for 7 Chlorothieno 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Genomics 2021Quote: ... and transferred to a plastic scintillation vial containing 10 mL of OptPhase HiSafe 3 scintillation cocktail (PerkinElmer, Waltman, MA, USA). All vials were counted for 10min using a Tri-Carb 2810 TR liquid scintillation analyzer (PerkinElmer ...
-
bioRxiv - Genomics 2021Quote: ... Aliquots of 10E6 nuclei were subjected to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) and PRO-seq libraries were constructed in duplicate as described (31) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were anesthetized with 3% isoflurane before retro-orbital injection with d-luciferin (150mg/Kg) (Perkin Elmer S.L., Cat. 122796) and imaged with an IVIS Xenogen machine (Caliper Life Sciences) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse primer contained an Illumina 3’ adapter sequence and an index sequence to uniquely identify each library (NextFlex DNA barcodes, PerkinElmer). Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed 3 days after injection of tumour cells and once weekly thereafter using an IVIS Spectrum in vivo Imaging System (PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). Following 1-week post-injection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of RNA was 3’-end-labeled with 32pCp (prepared by incubating 16.5 µl of γ-32P-ATP (PerkinElmer), 1 µl of T4 polynucleotide Kinase ...
-
bioRxiv - Microbiology 2022Quote: ... 48 hpi liver-stage cultures were washed with PBS and lysed in Nano-Glo Luciferase Assay buffer containing Nano-Glo Luciferase Assay substrate diluted 1:200 and luminescence was measured after 3 minutes on an IVIS Specturum CT (PerkinElmer). To monitor merosome detachment at 65 hpi ...
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Biochemistry 2023Quote: ... The hydrolysis reaction was then measured by absorbance at 630nm (read time of 0.1s per well, Victor 3 from Perkin Elmer) after incubating with malachite green reagent for a minimum of 8min under agitation.
-
bioRxiv - Cell Biology 2022Quote: ... Hybridization signals were detected by a chromogenic reaction using red chromogen dilution 1:3000 (PerkinElmer TSA Plus Cyanine 3 System). RNA-staining signal was identified as red punctate dots and clusters ...
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 pseudovirus productions were quantified by p24 ELISA (Perkin Elmer Life Sciences).
-
bioRxiv - Biochemistry 2020Quote: ... 2 μM mononucleosomes and 5.0 μM S-[methyl-14C]-adenosyl-l-methionine (PerkinElmer, #NEC363050UC) in the presence or absence of stimulatory or control peptides in concentrations as indicated in the text ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... which contains inhibitors and 1 μCi D-[2-3H]-glucose (23.4 Ci/mmol, PerkinElmer). After 30 s’ reaction ...
-
bioRxiv - Physiology 2020Quote: ... 0.35 ml of transport solution with 0.5 µCi/ml [3H]2-deoxy-glucose (PerkinElmer) was added to the cells for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli tRNA nucleotidyltransferase and [α-32P] ATP (final activity 2 µCi/µL) (PerkinElmer, # BLU003X250UC) in 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 pseudovirus productions were quantified by p24 ELISA (Perkin Elmer Life Sciences).
-
bioRxiv - Molecular Biology 2022Quote: The oligonucleotide substrates (Supplementary Table 2) were 5’-labelled with [γ-32P]ATP (PerkinElmer) and T4 polynucleotidyl kinase (PNK ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μL 10X T4 PNK buffer and 2 μL [γ-32P] ATP (Perkin Elmer). The volume was adjusted to 10 μL with water and incubated at 37°C for 1 hour ...
-
bioRxiv - Physiology 2023Quote: ... a bolus injection of 2-[1,2-3H(N)]deoxy-D-glucose (PerkinElmer, Boston, Massachusetts) (0.4 μCi/g body weight ...
-
bioRxiv - Cell Biology 2023Quote: ... The colorimetric reaction was read by Wallac 1420 Victor 2 (Perkin Elmer, Waltham, MA) or Synergy H1 microplate reader (BioTek ...
-
bioRxiv - Cell Biology 2020Quote: ... and medium was exchanged for Leibovitz L-15 CO2-independent medium for imaging at 37°C on a spinning disc confocal system (Ultraview Vox, PerkinElmer) with a 100 × 1.4 NA oil-immersion objective ...
-
bioRxiv - Microbiology 2020Quote: ... the plates containing infected macrophages were incubated at 37°C with 5% CO2 for 18 h in an Operetta High-Content Imaging System (PerkinElmer). During this 18 h incubation ...
-
bioRxiv - Developmental Biology 2021Quote: ... the cells were incubated for 5 minutes at 37°C with 55µCi/well of 35S-L-methionine and 35S-L-cysteine Promix (Perkin Elmer) in a minimal volume of culture medium ...
-
bioRxiv - Cell Biology 2022Quote: Images of embryos were acquired at 23°C using a PerkinElmer ERS spinning disk confocal system mounted on a Zeiss Axiovet 200M microscope using Volocity software (PerkinElmer). A 63X ...
-
bioRxiv - Biophysics 2022Quote: ... incubated for 4 h at 37°C and fluorescent signal intensity was quantified using the EnSpire Multimode Plate Reader (PerkinElmer) at excitation and emission wavelengths of 540 and 612 nm respectively.
-
bioRxiv - Cell Biology 2022Quote: ... cell motility was acquired using temperature (37°C) and CO2 (5%) controlled Operetta CLS High-Content Analysis System (PerkinElmer, HH16000000) (non-confocal ...
-
bioRxiv - Immunology 2019Quote: ... 0.1% BSA) and subsequently incubated for 30 min at 25°C with Nickel Chelate acceptor beads (Perkin Elmer, Waltham, MA) and Streptavidin conjugated donor beads (Perkin Elmer) ...
-
bioRxiv - Cell Biology 2019Quote: ... and media exchanged for Leibovitz L-15 CO2-independent medium for imaging at 37 °C on a spinning disc confocal system (Ultraview Vox; PerkinElmer) with a 100× 1.4 NA oil-immersion objective ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions containing 200 ng of mRNA and 0.1 mM of D-luciferin were carried out in 5 μL aliquots at 37°C for 15 minutes and the activity of in vitro synthesized luciferase was measured by VictorX5 (PerkinElmer) every 30 seconds.
-
bioRxiv - Biochemistry 2021Quote: ... Fluorescence intensity (Ex = 485 nm/Em = 535 nm) was monitored at 37 °C with a microplate reader VictorIII (Perkin Elmer). A calibration curve was created by measuring multiple concentrations (from 0.001 to 5 μM ...
-
bioRxiv - Biochemistry 2021Quote: ... The samples were boiled at 95°C for 10 min and subjected directly to LabChip GX II capillary gel electrophoresis (PerkinElmer) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... TR-FRET readout was performed after 1 h incubation at 4°C using an EnVision 2105 Multimode Plate Reader (PerkinElmer) with previously defined measurement parameters53 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Live-cell imaging was performed in a humidified environment at 37°C using a spinning-disc confocal microscopy system (UltraVIEW Vox; PerkinElmer) and a charge-coupled device camera (ORCA-R2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... with the confocal setting at 40X magnification at 37°C and 5% CO2 and analyzed with Columbus Image Analysis System (PerkinElmer). Each well was excited with 425 nm light and emissions detected at 434-515 nm for CFP and 500-550 nm for YFP ...
-
bioRxiv - Neuroscience 2022Quote: ... The samples were incubated for 30 min at 37 °C in the presence of the EasyTag Express Protein Labeling Mix 35S (PerkinElmer), pelleted ...
-
bioRxiv - Neuroscience 2022Quote: ... To quantify α1-3;5GABAAR79 sections were incubated for 60 minutes at 4°C in 1nM [3H]flumazenil (Perkin Elmer, NET757001MC), or in 1nM [3H]flumazenil with 10 µM flunitrazepam (Sigma Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 20 μl of the reaction mixture was incubated at 26°C for 1 h in a 384-well AlphaPlate (PerkinElmer). Subsequently ...
-
bioRxiv - Biochemistry 2021Quote: ... microsomes prepared from HEK293 cells expressing RyR2 were incubated for 1 h at 25 °C with 5 nM [3H]ryanodine (PerkinElmer) in reaction media containing 0.17 M NaCl ...
-
bioRxiv - Cell Biology 2020Quote: Embryos and third instar larval larval brains were imaged at 21°C on a Perkin Elmer ERS spinning disk (Volocity software version 6.3, PerkinElmer Inc.) mounted on a Zeiss Axiovert 200M microscope using a 63X/1.4-NA oil immersion objective and an Orca ER CCD camera (Hamamatsu Photonics) ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Reactions were incubated at 25 °C for 10mins followed by addition of 5 μCi of [γ-32P] ATP(Perkin Elmer). Reactions were incubated for additional 30 mins at 37 °C and were stopped using 3X Laemmli buffer ...
-
bioRxiv - Microbiology 2022Quote: ... maintained at 200 °C and with N2 as the gas vector (flow rate of 6 mL·min-1) with a flame ionization detector (FID) maintained at 280 °C (PerkinElmer, USA)
-
bioRxiv - Bioengineering 2022Quote: ... The volatiles were desorbed again by heating (200°C) in an Automatic Thermal Desorber (ATD-400, Perkin Elmer, Norwalk, CN), cryofocused on a cold trap (-30 °C) ...
-
bioRxiv - Biochemistry 2022Quote: ... Steady-state binding signal was obtained after incubation of reactions for 1 hr at 25° C using a EnSight Multimode plate reader (PerkinElmer) with a 30 ms excitation at 680 nm and emission measured at 615 nm after 140 ms ...