Labshake search
Citations for PerkinElmer :
351 - 400 of 431 citations for Fluorescein alkynylamino atp since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... was used for hybridization with oligonucleotides 5’-end labeled with 6,000 Ci/mmol γ-32P ATP (Perkin Elmer) using T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5 mM DTT, 0.5% Sarkosyl, 0.4 U/µl RNase inhibitor, 0.025 mM biotin-ATP/CTP/GTP/UTP [Perkin Elmer]). Total RNA was extracted using Trizol and ethanol precipitation ...
-
bioRxiv - Bioengineering 2022Quote: ATP levels in live cells were assessed by bioluminescence on the IVIS Spectrum in vivo imaging system (PerkinElmer) after adding 150 μg/mL of D-luciferin (PerkinElmer) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The [γ-32P]ATP (3,000 Ci/mmol) and [α-32P]dATP (3,000 Ci/mmol) were supplied by PerkinElmer. Oligonucleotides sp1 (5’-GATCACAGTGAGTAC) ...
-
bioRxiv - Genomics 2020Quote: ... washing (3 times 5 min in TNT) and 8 min incubation using Fluorescein Tyramide (for pimonidazole NEL701A001KT, perkin Elmer) or Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent.
-
bioRxiv - Neuroscience 2021Quote: ... The signal of CCK hybridization was revealed by a TSA reaction using fluorescein isothiocyanate (FITC)-labeled tyramide (1:100 for 10 minutes, NEL741001KT Perkin Elmer). After several washes ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1 hour later the emissions of Coumarin (445 nm) and Fluorescein (520 nm) were determined after excitation at 400 nm using an Envision plate reader (Perkin Elmer). An emission ratio (445 nm/520 nm ...
-
bioRxiv - Physiology 2021Quote: ... immunoprecipitates were analyzed for kinase activity in presence of phosphatidylinositol (PI) and γ-32P-ATP (PerkinElmer, Santa Clara, CA) followed a published method 91 ...
-
bioRxiv - Microbiology 2022Quote: ... one ml of culture was labelled for 4 min at 30 °C using 30 μCi γ-[32P]ATP (PerkinElmer). Samples were incubated with 6% sucrose ...
-
bioRxiv - Cancer Biology 2022Quote: ... ATP was measured in supernatants according to the protocol described by the ATPlite 1 step Luminescence Assay System (PerkinElmer). Luminescence readings were obtained from a Bioteck Synergy HT plate reader ...
-
bioRxiv - Biochemistry 2021Quote: ... The reactions that monitored [32P]AMP formation were supplemented with [α-32P]ATP (0.01-0.1 mCi/mL) (Perkin Elmer) while the reactions that monitored AA-[32P]tRNA were supplemented with [32P]tRNA (0.01-0.1 mCi/mL) ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: Autophosphorylation of YegI and point mutants was performed by addition of 5 μCi of [γ-32P] ATP (Perkin Elmer) to 0.2 μM of purified YegI or YegI point mutants in 10 μl of reaction buffer containing 50 mM Tris pH 7.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... Emitted light corresponding to the number of ATPs was measured in a Victor® XLight Multimode Plate Reader (PerkinElmer). For each sample ...
-
bioRxiv - Immunology 2023Quote: ... 5x104 of cells were resuspended in 150ul of phenol-free RPMI media and spiked with 20uM of ATP (PerkinElmer). After 30min of incubation at 37°C supernatants were collected ...
-
bioRxiv - Molecular Biology 2023Quote: ... with a total length of 109 ntb was prepared by 5′-end-labelling using [γ-32P]- ATP (Perkin Elmer) and T4 polynucleotide kinase (Thermo Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 μM purified IKK2 protein was first autophosphorylated in the presence of 100-200 nM of γ32P-ATP (PerkinElmer) in kinase assay buffer for 1 hour at 30°C ...
-
bioRxiv - Microbiology 2022Quote: ... oligonucleotides were 5’-end-labelled with [γ-32P]-ATP (10 mCi ml-1, 3000 Ci mmol-1, Perkin Elmer) with polynucleotide kinase (Thermo Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... Extracted crRNAs were end-labeled with T4 Polynucleotide Kinase in a reaction containing γ-[32P]-ATP (PerkinElmer, MA, USA), and resolved on an 8% Urea PAGE ...
-
bioRxiv - Immunology 2023Quote: ... 5x104 of cells were resuspended in 150ul of phenol free RPMI media and spiked with 20uM of ATP (PerkinElmer). After 10min of incubation at 37°C supernatants were collected and concentration of ATP/sample was measured using ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Neuroscience 2023Quote: ... CaMKII activity was assessed by its ability to transfer a radioactive phosphate from ψ32P-ATP (Perkin Elmer, Shelton, CT) onto the highly selective peptide substrate Autocamtide-2 (amino acid sequence KKALRRQETVDAL ...
-
bioRxiv - Neuroscience 2020Quote: ... Double immunofluorescence was performed using tetramethyl rhodamine labelled secondary antibody for alpha-synuclein and NSF with the fluorescein signal amplification kit (Perkin Elmer, UK). Following adequate washes to remove background fluorescence ...
-
bioRxiv - Biochemistry 2020Quote: ... the sections were washed and blocked with TN with 0.5% (w/v) Blocking Reagent TSA fluorescein system (Perkin Elmer, Waltham, MA, USA) for 30 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 3-plex positive control probe or with a cocktail of Abcb5-C1 and Abcb4-C2 probes with a 1:750 dilution of TSA-Fluorescein Plus and TSA-Cyanine 3 Plus (PerkinElmer, Shelton, CT), respectively ...
-
bioRxiv - Neuroscience 2021Quote: ... the sections were incubated with a horseradish peroxidase-conjugated anti-fluorescein antibody (diluted 1:500 with DIG-1, PerkinElmer, Foster City, CA) for 1 h and washed twice with DIG-1 for 5 min each time ...
-
bioRxiv - Genetics 2020Quote: ... 50 U of DNA polymerase I (M0209S) and 30 μM of each dNTP including 6 μM of Fluorescein-12-dATP (Perkin Elmer, NEL465001EA) or 6 μM of Texas Red-5-dATP (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2023Quote: ... The phospho-peptide product was measured by time-resolved fluorescence resonance energy transfer (TR FRET) between the terbium of the antibody and fluorescein of the phospho-peptide using an EnVision plate reader (PerkinElmer, Waltham, MA) equipped to detect the TR-FRET signal (excitation 320 nm ...
-
bioRxiv - Immunology 2023Quote: ... Hybridization signals were detected by fluorescent signal using peroxidase-based Tyramide Signal Amplification-Plus Fluorescein or TSA Plus Cyanine 5 (Perkinelmer, Shelton, CT). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... the reactions were started by adding 5× NTP mixture (1 mM for ATP, CTP and GTP, 0.1 mM for UTP) containing 2 µCi of [α−32P] UTP (PerkinElmer). Transcription reactions were performed at 37°C for 20 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Then 5 µl of each diluted cell lysate was mixed with 15 µl of cell lysis buffer containing 0.33 mM ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.) in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... was phosphorylated in vitro with His-MBP-PknBMtb at 0.015 μg/μl for 30 minutes at room temperature with 0.15μCi/μl ATP [γ-32P] (5×10-8 μmol) (3000Ci/mmol, 10mCi/ml, PerkinElmer BLU002A250UC) and 2mM MnCl2 in buffer (50mM Tris ...
-
bioRxiv - Microbiology 2021Quote: ... coli TMPK catalysis was measured in the direction of ATP synthesis using the ATPlite luminescence assay (PerkinElmer cat. no. #6016739) in white 384-well plates (Corning cat ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Reactions were incubated at 25 °C for 10mins followed by addition of 5 μCi of [γ-32P] ATP(Perkin Elmer). Reactions were incubated for additional 30 mins at 37 °C and were stopped using 3X Laemmli buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 mg of purified GST-fusion protein (unedited Cpx7AI125,N130 or edited Cpx7AI125M,N130S) was used per reaction and incubated with 2,500 units of recombinant kinase and [32P]ATP (Perkin Elmer). Reaction products were separated by SDS-PAGE and gels were stained with Bio-Safe Coomassie Blue (Bio-Rad) ...
-
bioRxiv - Neuroscience 2022Quote: ... The amount of produced ATP was measured as a luminescence signal of luciferase activity using the Nivo S luminometer (PerkinElmer). The luminescent signal is proportional to the ADP concentration generated and reflects the Pak activity.
-
bioRxiv - Cancer Biology 2024Quote: ... Change in initial ATP concentration was measured as bioluminescence readout in counts per second on the Envision plate reader (PerkinElmer).
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of RNA was 3’-end-labeled with 32pCp (prepared by incubating 16.5 µl of γ-32P-ATP (PerkinElmer), 1 µl of T4 polynucleotide Kinase ...
-
bioRxiv - Immunology 2023Quote: ... After 10min of incubation at 37°C supernatants were collected and concentration of ATP/sample was measured using ATPlite Luminescence Assay System (PerkinElmer) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... RV-B14 RNA was detected using an RVB RNA probe (Advanced Cell Diagnostics, Cat. No. 447141) and TSA Plus Fluorescein (PerkinElmer, Cat. No. NEL741E001KT). FISH images were acquired and analyzed using a TissueFAXS 200 flow-type tissue quantitative analyser (TissueGnostics GmbH ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were washed again in PBS with 0.1% Tween-20 six times for 1 hour and incubated in fluorescein tyramide reagent (Perkin Elmer, Cat. No. SAT701001EA) diluted 1:70 in amplification diluent for 50 minutes at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... often from an ImmPRESS® polymer detection kit followed by colour development using a tyramide signal amplification system kit with cyanine (Cy)3 or fluorescein (1:50 dilution; PerkinElmer, Waltham, MA, USA). For detection of the second antigen in dual immunofluorescence ...
-
bioRxiv - Molecular Biology 2022Quote: ... Double fluorescence TSA was carried out using FITC-labeled doRPS12 and DIG-labeled doSRSF1 RNA probes detected with HRP-labeled anti-fluorescein and Cy3-conjugated Tyramide or HRP-labeled anti-digoxigenin antibodies with Cy5-conjugated Tyramide (PerkinElmer, Waltham, MA, USA). After probe hybridization and washing ...
-
bioRxiv - Neuroscience 2021Quote: ... or 3.3 mM (Figure 5-figure supplement 1 and 8) ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.), in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 100-bp mini-circle was prepared as follows: oligos cb1027 and cb1028 were labeled with [γ-32P]-ATP (Perkin Elmer) by T4 polynucleotide kinase ...
-
bioRxiv - Genomics 2020Quote: ... 5 mM MgCl2, 1 mM DTT, 300 mM KCl, 40 µM ATP, 40 µM GTP, 40 µM Biotin-11-CTP [Perkin Elmer] ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mL of cells from each culture pulsed with 1 μCi [γ32P]-ATP having a specific activity of 30 Ci/mmol (Perkin Elmer) for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Oligonucleotide probes (listed in Supplementary Table S2) were 5′ 32P-end labeled with 0.3 mCi of γ-32P ATP (Perkin Elmer) by incubating with 10 U of T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... the reactions were rapidly diluted in a saturating concentration of ATP and the TR-FRET signal was measured continuously in a multiplate reader Envision (Perkin Elmer).
-
bioRxiv - Cancer Biology 2022Quote: Tritiated cGAMP was synthesized via a bio-catalytic reaction in which recombinant cGAMP synthase preactivated with herring DNA was incubated with [3H]-ATP (Perkin Elmer) and [3H]-GTP (Perkin Elmer ...
-
bioRxiv - Biochemistry 2020Quote: ... The 500 nM annealed DNA substrates were then radiolabeled in PNK buffer with PNK enzyme and radioactive ATP [γ32P] from Perkin Elmer at 37°C for 1 hr then diluted in TE buffer (10 mM Tris ...