Labshake search
Citations for PerkinElmer :
251 - 300 of 531 citations for Fmoc S 3 amino 4 3 4 dichloro phenyl butyric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse primer contained an Illumina 3’ adapter sequence and an index sequence to uniquely identify each library (NextFlex DNA barcodes, PerkinElmer). Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed 3 days after injection of tumour cells and once weekly thereafter using an IVIS Spectrum in vivo Imaging System (PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). Following 1-week post-injection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Microbiology 2022Quote: ... 48 hpi liver-stage cultures were washed with PBS and lysed in Nano-Glo Luciferase Assay buffer containing Nano-Glo Luciferase Assay substrate diluted 1:200 and luminescence was measured after 3 minutes on an IVIS Specturum CT (PerkinElmer). To monitor merosome detachment at 65 hpi ...
-
bioRxiv - Biochemistry 2023Quote: ... The hydrolysis reaction was then measured by absorbance at 630nm (read time of 0.1s per well, Victor 3 from Perkin Elmer) after incubating with malachite green reagent for a minimum of 8min under agitation.
-
bioRxiv - Cell Biology 2022Quote: ... Hybridization signals were detected by a chromogenic reaction using red chromogen dilution 1:3000 (PerkinElmer TSA Plus Cyanine 3 System). RNA-staining signal was identified as red punctate dots and clusters ...
-
bioRxiv - Genomics 2022Quote: ... nuclei were extracted from ~2×107 cells and run-on reactions were carried on at 37°C for 3 minutes using 3μl of each 11-biotin-labelled ribonucleotide stocks (Perkin Elmer). Following real time PCR amplification in the presence of EvaGreen dye as above ...
-
bioRxiv - Cell Biology 2024Quote: ... Fresh mouse cardiac biopsies (1 biopsy ∼1-3 mg/well) were distributed in a 96-well white microplate (OptiPlate-96; PerkinElmer) and incubated or not (basal ...
-
bioRxiv - Cell Biology 2024Quote: The glucose uptake was determined by seeding hBMSCs (passage 3) in a 96-well black/clear bottom plate (Perkin Elmer) at a density of 6,000 cells/well (6 wells/group) ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 µM [methyl-3H] S-adenosyl methionine (PerkinElmer), 10 µM substrate RNA/DNA probe ...
-
bioRxiv - Pathology 2023Quote: 14C-labeled palmitic acid (C16) and 14C-octanoic acid (C8) were from PerkinElmer while 14C-DC12 and 14C-lignoceric acid (C24 ...
-
bioRxiv - Physiology 2024Quote: ... A mixture of 14C-oleic acid (Oleic Acid, [1-14C]-, NEC317050UC, Perkin Elmer) and fatty acid free and endotoxin free bovine serum albumin (A8806-1G ...
-
bioRxiv - Cell Biology 2020Quote: ... and all qualitative imaging of Kif19 plasmids were conducted on a 4-D spinning-disk confocal microscope (PerkinElmer) with 60x (1.4 NA ...
-
bioRxiv - Neuroscience 2020Quote: ... TR-FRET measurements were routinely performed following overnight incubation at 4°C using an EnVision Reader (Perkin Elmer). Values were collected as the background subtracted ratio between fluorescence emission at 665 nm and 615 nm where the background signal corresponds to the ratio (665/615 ...
-
bioRxiv - Neuroscience 2021Quote: ... the free-floating sections were incubated overnight at 4°C with Streptavidin-Texas Red (1:400, NEL721001EA PerkinElmer). Finally ...
-
bioRxiv - Microbiology 2021Quote: KN99α was grown as described above in MM supplemented with 2 μCi/ml 3H-NE and 1.0 mM unlabeled NE or a mixture of 1.0 mM unlabeled NE and DA or with 4 μCi/mL (0.0001 mM) Dihydroxyphenylethylamine 3,4-[Ring-2,5,6-3H] (3H-DA, Perkin Elmer NET673250UC) and 1.0 mM unlabeled DA or 1.0 mM unlabeled NE and DA for 10 d at 30°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... or 4 µl of suspension was carefully distributed in the centre of an optical-bottom 96-well (PerkinElmer) for immunofluorescence experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... Live imaging was done 4-8h later using a spinning disk confocal microscope (Perkin Elmer Ultra View ERS) equipped with a heating chamber (37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... filters were placed into scintillation vials with 4 mL Emulsifier-safe liquid scintillation fluid (Perkin Elmer, Waltham, MA) and analyzed using a liquid scintillation counter ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were fixed in 4% PFA and imaged with the Opera Phenix High Content Screening System (Perkin Elmer), acquiring at least 10 images per well ...
-
bioRxiv - Cell Biology 2023Quote: ... the rabbit reticulocyte lysate master mix was supplemented with EasyTag L-35-Methionine (4% final reaction volume; PerkinElmer). Canine rough pancreatic microsomes (cRMs ...
-
bioRxiv - Immunology 2022Quote: ... Prior to the immunization all mice were anesthetized by isoflurane inhalation with RAS-4 Rodent Anesthesia System (PerkinElmer). Mice were euthanized on day 28 for terminal blood collection and spleens were harvested for cellular assays ...
-
bioRxiv - Cancer Biology 2020Quote: ... the extent of lung metastasis was measured every 3 days for 12 days using non-invasive imaging with IVIS Lumina III (Perkin Elmer). In brief ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both supernatant and lysate were moved to separate counting vials and mixed with 3 mL scintillation fluid (Ultima Gold #6013321, Perkin Elmer). 14C levels were measured in each sample using a Packard Liquid Scintillation Analyzer ...
-
bioRxiv - Biochemistry 2020Quote: ... The membrane was transferred to a tube and the protein-bound [α-32P]dCTP was quantified in a Beckman Coulter LS 6500 Liquid Scintillation Counter using OptiPhase HiSafe 3 (PerkinElmer) as solvent.
-
bioRxiv - Bioengineering 2021Quote: ... Mice were administered 3.3 mg D-Luciferin in the morning of day 3 and luminescence was recorded after 10 minutes by an In Vivo Imaging System (IVIS, Perkin Elmer) followed by i.v ...
-
bioRxiv - Neuroscience 2020Quote: ... was used as a secondary fluorophore for C1 probes (Gtpbp2, Slc7a1, Chac1) and TSA® Plus Cyanine 3 (PerkinElmer, 1:2,000) was used as a secondary fluorophore for C2 probes (Gtpbp1 ...
-
bioRxiv - Microbiology 2022Quote: ... The bound calcofluor was measured at excitation (λEx) 350 nm and emission (λEm) of 475 nm with VICTOR 3 1420 Multilabel Counter (PerkinElmer, USA).
-
bioRxiv - Microbiology 2022Quote: ... Animals were anaesthetized using an oxygen-filled induction chamber with 3% isoflurane and bioluminescence was measured using the in vivo imaging system IVIS (IVIS Spectrum Imaging System, Perkin Elmer). Mice were whole-body imaged in dorsal position and the signal intensity was obtained from luciferase expressed in T ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were incubated at restrictive temperature (37°C) for 3 h and finally transfer to 384-well CellCarrier plates (PerkinElmer, 6007550) for imaging on an Opera QEHS high-content screening microscope (PerkinElmer) ...
-
Peripheral neuropathy linked mRNA export factor GANP reshapes gene regulation in human motor neuronsbioRxiv - Neuroscience 2021Quote: ... were hybridized for 2 h at 40°C followed by signal amplification and developing the HRP channel with TSA Plus fluorophore Cyanine 3 (1:1500) (NEL744001KT, Perkin Elmer) according to the manual ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2020Quote: ... the cultures added with 0.05% v/v DCPK and fluorescent emission for the next 3 hours followed as described in detail in (21) with a Gallios (Perkin Elmer) flow cytometer ...
-
bioRxiv - Neuroscience 2020Quote: ... Imaging was performed at 37°C and 3% CO2 using an Opera Phenix™ high-content confocal microscopy system (Perkin Elmer). Images were acquired at 40x magnification using a 425 nm laser for excitation of CFP and emissions detected at 435-515 nm (CFP ...
-
bioRxiv - Microbiology 2020Quote: ... The dry filter paper was exposed to film for imaging before the individual dots on the filter paper were excised and scintillated with the addition of 3 ml scintillation fluid (Perkin Elmer). Radioactive counts were measured as scintillation counts per minute.
-
bioRxiv - Molecular Biology 2023Quote: ... the reaction was initiated by the addition of 3 μl of 2 mM [ψ-32P]ATP (222 TBq/mmol Perkin Elmer) to the mixture (final concentration ...
-
bioRxiv - Microbiology 2023Quote: ... Oligonucleotide probes (listed in Supplementary file 3) for the different RNAs were labelled with 0.3 mCi of [γ-32P] ATP (Perkin Elmer) by incubating with 10 U of T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... 12 pictures of at least 3 biological replicates were quantified using the Harmony high-content imaging and analysis software (Perkin Elmer).
-
bioRxiv - Cell Biology 2024Quote: ... After two washes of 5min in 1X RNAscope wash buffer slides were incubated with 1:1500 Cyanine 3 amplification reagent (PerkinElmer, #FP1170012UG), or 1:1000 Cyanine 5 amplification reagent (PerkinElmer ...
-
bioRxiv - Immunology 2024Quote: Bacterial burden in MRSA /ux-infected mouse ears was monitored every 24 h for 3 or 7 consecutive days using an In Vivo Imaging System (IVIS) Spectrum (Perkin Elmer). Bacterial burden was quantified as the bioluminescence (radiance ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 pmol of DNA oligonucleotide (Eurofins MWG Operon, Germany) were 3’-end labelled with 3.3 pmol of α-32P-dATP (Perkin Elmer) using terminal deoxynucleotidyl transferase (TdT ...
-
bioRxiv - Immunology 2022Quote: ... β-radioactivity was measured by liquid scintillation counting in a Beckman LS 6500 Multi-Purpose Scintillation Counter (scintillant Optiphase HiSafe 3; PerkinElmer, #1200.437). L-Alanine (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.