Labshake search
Citations for PerkinElmer :
751 - 800 of 1063 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Purified RNA oligos were either phosphorylated with unlabeled ATP or 5’ end-labeled using [γ-32P] ATP (Perkin Elmer) and T4-Polynucleotide kinase (New England Biolabs) ...
-
bioRxiv - Genomics 2023Quote: ... The metabolite extract was transferred into scintillation vials with 5 mL Insta-Gel Plus scintillation cocktail (Perkin Elmer #601339).
-
bioRxiv - Neuroscience 2024Quote: ... we administered four intraperitoneal injections of 3H-Thy at 2 hrs intervals to adult mice (1.67 μL/g body weight, specific activity 5 Ci/mmol; PerkinElmer) with subsequent perfusion 2 hrs after the last injection (n = 3) ...
-
bioRxiv - Neuroscience 2024Quote: HB(T)MVECs were incubated for 6 hours in EGM-2 containing 0.4 μCi/ml [5-3H]-D-glucose (PerkinElmer). Supernatant was transferred into glass vials containing perchloric acid and sealed with rubber stoppers ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... where reactions were incubated with 150 nM of the gel-filtration purified WT mouse Naa10 or Naa12 in a 30 µl reaction volume containing each 250 µM substrate peptide and radiolabeled [14C]acetyl-CoA (4 mCi/mmol; PerkinElmer Life Sciences) for 12 min (Naa12 ...
-
bioRxiv - Biophysics 2021Quote: ... 50 nM SpNatC (WT or mutants) was mixed with 50 μM Ac-CoA (14C-labeled, 4 mCi mmol-1; PerkinElmer Life Sciences) and varying peptide concentrations (ranging from 1.95 μM to 500 μM ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...
-
bioRxiv - Neuroscience 2023Quote: ... Half of the cell Triton X lysate from each well was pipetted into a scintillation vial and 4 ml of scintillation fluid (#6013329, Ultima GoldTM, Perkin Elmer, USA) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... were prepared in in vitro transcription reaction on linear PCR-generated template containing RNAImod (4) with 500 μM ATP or NAD and 25 μM [α 32P] CTP (Perkin Elmer) using hexa-histidine tagged E ...
-
bioRxiv - Microbiology 2024Quote: ... Mixtures were incubated for 60 min at room temperature prior to adding 4 µl of D-luciferin (30 mg/ml) (Perkin Elmer; #122799). After additional incubation for 5 min ...
-
bioRxiv - Cancer Biology 2021Quote: In vitro methyltransferase assays were performed using 30 ul reaction buffer (50 mM Tris-HCl pH 7.8, 50 mM KCl, 5 mM MgCl2) with 1 ul 3H-AdoMet (Perkin Elmer, specifific activity = 55-85 Ci/mMole,0.55 μCi/ul ...
-
bioRxiv - Cell Biology 2020Quote: ... and labeled for 5 min with with 1 μL per OD of cells of EXPRESS 35S Protein Labeling Mix (PerkinElmer) for 5 or 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... the plates containing infected macrophages were incubated at 37°C with 5% CO2 for 18 h in an Operetta High-Content Imaging System (PerkinElmer). During this 18 h incubation ...
-
bioRxiv - Developmental Biology 2021Quote: ... the cells were incubated for 5 minutes at 37°C with 55µCi/well of 35S-L-methionine and 35S-L-cysteine Promix (Perkin Elmer) in a minimal volume of culture medium ...
-
bioRxiv - Cell Biology 2022Quote: ... cell motility was acquired using temperature (37°C) and CO2 (5%) controlled Operetta CLS High-Content Analysis System (PerkinElmer, HH16000000) (non-confocal ...
-
bioRxiv - Microbiology 2021Quote: ... 1.37 μg/mL of RBD and 5 μg/mL of Ecto) and incubated overnight in protein-binding 96-well plates (PerkinElmer). The next day ...
-
bioRxiv - Neuroscience 2021Quote: ... plates were centrifuged once more under same conditions mentioned above and 5 µL of each FRET antibody pair was added (2.5 nM final concentration for donor and 5 nM for acceptor, diluted in 1x Lance buffer, (Perkin Elmer)) ...
-
bioRxiv - Microbiology 2021Quote: ... and fluorescence at 355 nm excitation and 460 nm emission was monitored every 5 minutes for 50 minutes using an Envision plate reader (PerkinElmer). Rate of substrate cleavage was determined using linear regression of the raw data values obtained during the time course ...
-
bioRxiv - Neuroscience 2022Quote: ... Nifene or nicotine respectively for 5 min followed by addition of 2.5 nM [125I]-epibatidine ([125I]Epb) (2200 Ci/mmol; Perkin Elmer) and incubation for 20 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10-15 minutes later for 60 seconds ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10 minutes later ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 100-µL sterile PBS were injected into the left cardiac ventricle of female 5-week-old NSG mice as described previously (50) and in vivo imaging was performed (IVIS Spectrum, PerkinElmer) immediately to verify widespread seeding of tumor cells ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Molecular Biology 2020Quote: ... with the confocal setting at 40X magnification at 37°C and 5% CO2 and analyzed with Columbus Image Analysis System (PerkinElmer). Each well was excited with 425 nm light and emissions detected at 434-515 nm for CFP and 500-550 nm for YFP ...
-
bioRxiv - Plant Biology 2021Quote: ... The pellet was resuspended in 100 μl PIB and transferred to a scintillation vial containing 5 ml Ultima Gold XR Scintillation liquid (PerkinElmer). Radioactivity for each vial was measured by liquid scintillation spectrometry.
-
bioRxiv - Cancer Biology 2020Quote: ... The filters were washed with 5 ml wash buffer and counted using a liquid scintillation counter (Wallac 1450 MicroBeta Trilux, PerkinElmer). Exchange reactions with GST-Rab35 on glutathione-Sepharose beads were performed in the presence or absence of Arf5 ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated with 5 μL of biotinylated peptides at 100 nM for 30 min at room temperature in the epigenetics assay buffer (PerkinElmer AL008 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Emission intensity was recorded for 5 min using 460 nm and 530 nm filters on the EnVision or Victor X Light plate reader (PerkinElmer). Next ...
-
bioRxiv - Biochemistry 2021Quote: ... microsomes prepared from HEK293 cells expressing RyR2 were incubated for 1 h at 25 °C with 5 nM [3H]ryanodine (PerkinElmer) in reaction media containing 0.17 M NaCl ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Reactions were incubated at 25 °C for 10mins followed by addition of 5 μCi of [γ-32P] ATP(Perkin Elmer). Reactions were incubated for additional 30 mins at 37 °C and were stopped using 3X Laemmli buffer ...
-
bioRxiv - Cancer Biology 2021Quote: 4T1 cells were cultured for 6 h in RPMI medium containing 0.4 μCi ml−1 [5-3H]D-glucose (Perkin Elmer) after which the supernatant was transferred into glass vials sealed with rubber stoppers ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and incubated with TSA Plus Fluorescein (PerkinElmer) according to the manual at RT for 3-15 minutes (3-5 min in H ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and the amplification steps were repeated using anti-DNP-HRP Conjugate (PerkinElmer) and TSA Plus Cyanine 3 (PerkinElmer) ...
-
bioRxiv - Immunology 2023Quote: ... Successful tumor implantation was confirmed on day 5 by luminescence detection using an IVIS® Lumina S5 Imaging System (PerkinElmer). Animals were then randomized and received an intracranial intratumoral administration of 1×106 anti-PTPRZ1 RNA CAR-T cells or Mock EP T cells in 2 μL of HBSS on day 7 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each protein (5 µL) was mixed and incubated for 1 h in a 384-well AlphaPlate (PerkinElmer, Waltham, MA, USA). After diluting Alpha Screen Protein A Acceptor Beads (PerkinElmer ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.05□μl of 5□mM stock compounds in DMSO were dispensed into assay microplates with a Janus 384 MDT NanoHead (PerkinElmer). Final concentration of the screening compounds in the assay was 16LμM ...
-
bioRxiv - Bioengineering 2023Quote: ... The plasma was obtained by centrifugation at 500 g for 5 min and measured for MFI using IVIS (PerkinElmer, USA).
-
bioRxiv - Immunology 2023Quote: ... Tumor growth in live mouse was monitored every 5 days by bioluminescence imaging (BLI) using IVIS Spectrum In Vivo Imaging System (PerkinElmer) after 10mins intraperitoneally injection of 150mg/Kg D-luciferin ...
-
bioRxiv - Immunology 2024Quote: ... of luciferase activity in each well was measured within 5 min after the addition of substrate using a Victor X4 plate reader (PerkinElmer). After subtracting background luciferase activity in uninfected cells ...
-
bioRxiv - Immunology 2024Quote: ... Fluoforte® fluorescence (excitation 490 nM/emission 525 nM) was quantified at time 0 (baseline) and after 5 minutes on an Envision plate reader (PerkinElmer). Normalized relative fluorescence units (ΔRFU ...
-
bioRxiv - Cell Biology 2024Quote: ... Tem1 (3.3 µM final concentration) was mixed with GTP (33 µM final) supplemented with 5 µCi [α-32P]-GTP (PerkinElmer) in the reaction buffer (20 mM HEPES pH 7.5 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Filters with the bound radioligand were transferred to vials containing 5 mL of Ultima Gold cocktail (PerkinElmer, Boston, MA, USA) and measured with a Packard Tri-Carb 2200CA liquid scintillation counter (PerkinElmer ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Microtubes were then centrifuged at 1000g for 5 min and radiolabeled lipids were counted in the upper phase with a Tri-Carb 4910TR liquid scintillation counter (PerkinElmer). Results were normalized to total protein content and expressed in comparison to control cells.
-
bioRxiv - Microbiology 2024Quote: ... The bacterial mCherry signal was measured on day 0 and day 5 post infection on an Envision plate reader (PerkinElmer). Oleate was maintained throughout the experiment in the rescue assay conditions.
-
bioRxiv - Systems Biology 2024Quote: ... They were then incubated with 0.5 ml of uptake solution containing [3H]glutamine (5 μCi/ml; Perkin Elmer, NET 55100) in either the presence ...
-
bioRxiv - Immunology 2024Quote: ... diluted 1:40 in assay diluent 5 and then IL-1β levels were measured using the Human IL- 1β HTRF kit (Cisbio – PerkinElmer), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Microtubes were centrifuged at 1000g for 5 min and radiolabeled lipids were counted in the upper phase with a Tri-Carb 4910TR liquid scintillation counter (PerkinElmer). Results were normalized to cell number as described for oxygen consumption.