Labshake search
Citations for Qiagen :
151 - 200 of 1376 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA for RNA-seq and RT-qPCR was isolated with the help of RNeasy minelute columns (Qiagen), following the addition of 400 μl of 70% RNase-free ethanol to the TRIzol homogenates and on-column DNaseI digests ...
-
bioRxiv - Neuroscience 2019Quote: ... The cDNA was measured in triplicates by RT-qPCR (reaction volume 15 l) using Rotor-Gene Q (Qiagen) and Brilliant III Ultra-Fast SYBR Green qPCR Master Mix (Agilent) ...
-
bioRxiv - Developmental Biology 2022Quote: Expression level of Cdc25a mRNA was measured by RT-qPCR using FastLane Cell SYBR Green kit (Qiagen, #216213) using CFX96 Touch Real-Time PCR Detection System ...
-
bioRxiv - Bioengineering 2023Quote: ... direct RT-qPCRs were performed on heat-inactivated samples without extraction using the QuantiTect Reverse Transcription Kit (Qiagen). The reactions were run in an Applied Biosystems QuantStudio 7 Flex System (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: Isolated miRNA content was quantified by real time quantitative PCR (RT-qPCR) using the miScript PCR Kit (Qiagen) with a CFX Connect Real-Time system (Bio-Rad) ...
-
bioRxiv - Bioengineering 2023Quote: ... The RT-qPCR experiments used Student’s t-test of the experimental group compared to the sham control (Qiagen GeneGlobe RT2 Profiler PCR Data Analysis) ...
-
bioRxiv - Cell Biology 2023Quote: RT-qPCR for siRNA validation was performed by extraction of RNA using the RNeasy Mini kit (Qiagen 74104) according to the manufacturer’s recommendations 24hr post siRNA transfection ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed in an Applied Biosystems QuantStudio 3 using the QuantiTect® Multiplex PCR Kit (QIAGEN). The primers and probes used are listed in Table S2 ...
-
bioRxiv - Plant Biology 2023Quote: Real-Time Quantitative PCR (RT-qPCR) was performed with the Rotor-Gene SYBR® Green PCR Kit (Qiagen), on a Rotor Gene-Q(R ...
-
bioRxiv - Cell Biology 2022Quote: ... and real-time RT-qPCR was performed with a Rotor-Gene SYBR Green PCR kit (Qiagen Inc., Germantown, MD) in a Rotor-Gene® Q real-time polymerase chain reaction machine (Qiagen Inc. ...
-
bioRxiv - Bioengineering 2024Quote: ... and qPCR reactions were performed using QuantiFast Multiplex PCR Master Mix (w/o ROX) (Qiagen, Redwood City, CA). Each biological replicate was assessed in technical quadruplicate on a 384-well CFX real-time qPCR instrument (Bio-Rad ...
-
bioRxiv - Microbiology 2019Quote: ... Mixes were prepared according to the manufacturer instructions (QuantiFast SYBR Green PCR, Qiagen, Toronto, Canada) with 1µl of 1:20 diluted cDNA and a final concentration of 1µM of each primer (Table.1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR reaction mixes were transferred into a 26K 24-well nanoplate (ID: 250001, Qiagen). Partitioning of the PCR mix was performed on the QIAcuity Four digital PCR system after sealing the plate ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV2 subgenomic viral RNA was quantified using primer probe sets as previously described (Wölfel et al., 2020) and Quantifast One-Step RT-PCR master mix (Qiagen) on a QuantStudio 3 or 5 instrument (ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: ... SYBR green real-time PCR assay was carried out in a 20μL PCR mixture volume consisting of 10 μL of 2X Quantitect SYBR green RT-PCR Master Mix (Qiagen) containing HotStarTaq DNA polymerase ...
-
bioRxiv - Plant Biology 2021Quote: The total RNA used for RT-qPCR analysis was isolated from rice or Arabidopsis tissues using an RNeasy system (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time qPCR reactions were run using the MESA Green qPCR MasterMix Plus for SYBR Green assay (Eurogenetec, RT-SY2X-03+WOU) on the Rotor-Gen Q device (Qiagen). Each sample was tested in triplicate ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was then diluted 25 times to serve as template for real-time quantitative PCR (RT-qPCR) using Rotor-Gene 6000 (Corbett Research, QIAgen), as previously described (Forlenza et al. ...
-
bioRxiv - Bioengineering 2021Quote: ... Total RNA (5 μl) was used for cDNA synthesis and qPCR was performed in one step using QuantiTect Probe RT-PCR (Qiagen) on a StepOnePlus System (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Gene expression was evaluated by qPCR using the ONE-step QuantiTect Probe RT-PCR Kit (Qiagen, Cat No./ID: 204445). For each reaction 2 μL of RNA were used ...
-
bioRxiv - Microbiology 2020Quote: ... EAV genome copy number was determined by one step RT-qPCR using the QuantiTect™ Virus + ROX Vial Kit (Qiagen). Each RNA sample was tested in triplicate ...
-
bioRxiv - Neuroscience 2020Quote: ... The quantitative real-time RT-PCR (qPCR) analysis for Bcl2l1 and Bcl2l11 was performed using a SYBR Green PCR Mix (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: Cytokines and cellular sensors were measured in neonatal lung homogenates (cDNA prepared as per viral titres) by RT-qPCR using QuantiFast SYBR Green PCR Kit (Qiagen) and QuantiTect Primer Assays (Qiagen ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR reactions were performed in triplicate with a Qiagen Rotor-Gene Q 5Plex real-time cycler (Qiagen, Germantown, MD). Transcript levels of each gene were calculated relative to that of PP2A ...
-
bioRxiv - Microbiology 2024Quote: ... reverse transcription quantitative PCR (RT-qPCR) assays were performed with the QuantiTect Virus + ROX Vial Kit (Qiagen, Toronto, ON, Canada) in a LightCycler® 480 system (Roche Molecular System) ...
-
bioRxiv - Bioengineering 2023Quote: ... was used as the master mix while the qPCR was performed using a RotorGene® (Qiagen N.V., Germany, Hilden). Before sequencing ...
-
bioRxiv - Immunology 2021Quote: Pathway-specific primer mixes (Rat Antibacterial Response, PBR-148Z, and Human Antibacterial Response, PBH-148Z; Qiagen) were used for preamplification and qPCR arrays (Rat Antibacterial Response ...
-
bioRxiv - Immunology 2023Quote: ... cDNAs were synthesized using High Capacity RNA-to-cDNA kit (ThermoFischer Scientific) and quantitative RT-PCR were carried out using specific primers (Table S2) and SYBR Green PCR Master Mix (Qiagen). PCR amplification of Gapdh was performed to control for sample loading and normalization between samples ...
-
bioRxiv - Cancer Biology 2021Quote: The preparation of RNA for RT-qPCR experiments was performed according to the manufacturer’s instructions using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany). Isolated RNA was transcribed into cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Plant Biology 2020Quote: ... RT-qPCR was performed in an Applied Biosystems QuantStudio 3 thermocycler using the QuantiNova Probe SYBR Green PCR Kit (Qiagen, Germany); mix proportions and cycling parameters were used as described in manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... All RNAs for the miRNA investigation were transcribed using miScript RT kits and subsequent qPCR performed using miScript Primer Assays and miScript SYBR kits (Qiagen, Courtaboeuf). Experiments were performed with at least triplicates for each data point ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: The preparation of RNA for RT-qPCR experiments was performed according to the manufacturer’s instructions using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany). Isolated RNA was transcribed into cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Immunology 2019Quote: ... 10 μl of the gene expression assay (RT2 SYBR Green ROX qPCR Master Mix) (cat. # 330520, Qiagen, Valencia, CA, USA) and 1 μl of the relevant mouse RT2 qPCR Primer Assay ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated as previously described.8 The cDNA and purified viral DNA were used for quantitative PCR (qPCR) using QuantiTect probe PCR master mix (Qiagen) and optimized concentrations of forward primer (TGTGTGGGAGACCATCAAGC) ...
-
bioRxiv - Plant Biology 2023Quote: ... assays were performed with triplicates of cDNA aliquots in 96-wells reaction plates using Quantinova qPCR SYBR Green Master Mix (QIAGEN) according to the manufacturer’s manual ...
-
bioRxiv - Immunology 2024Quote: ... cDNA was diluted to 5 ng/µl in RNase-free water and 1 µl used for real-time qPCR with Qiagen QuantiNova SYBR Green Master Mix (Qiagen) in a StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Bioengineering 2020Quote: ... A Qiagen RT2 SYBR Green master mix with validated qPCR human primers (for HUVECs and BeWo) or mouse primers (for N27 cells) from Qiagen (Frederick) were used to determine relative magnitudes of gene-expression levels using RT-PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instruction and the resulting cDNA was used for reverse transcription-polymerase chain reaction (RT-PCR) using HotStarTaq Plus Master Mix Kit (Qiagen, Germantown, MD). The PCR conditions used were as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... to Rotor-Gene strip reaction tubes (Starlab, 22143, Hamburg, Germany) and RT-qPCR analysis was performed using the Rotor-Gene Q device (Qiagen, 40724, Hilden, Germany). RNase free H2O (Merck-Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative real-time PCR (qPCR) analysis was performed on an Applied Biosystems Real-Time PCR Systems using SYBR Green Master Mix (Qiagen, MD, USA). The thermal cycler conditions were as following ...
-
bioRxiv - Molecular Biology 2022Quote: ... Relative transcript levels were determined by pPCR using the 2x SYBR® Green qPCR Master Mix and a Rotor-Gene® Q thermal cycler (Qiagen). The transcript for the ribosomal protein L32 (rpl32 ...
-
bioRxiv - Physiology 2019Quote: ... qPCR was conducted using Quantitect Sybr Green qPCR (Qiagen) with the following primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... RT-PCR was performed using OneStep RT-PCR Kit (QIAGEN) using the following primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... the total reaction volume of 25 µl per sample included 12.5 µl TaqMan® qPCR master mix (QuantiTect® Multiplex PCR NoROX Kit (QIAGEN, Hilden, Germany), 1.25 µl of the respective primer/probe mix (Table 2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For RT (Qiagen) for miRNA isolation quality control ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on a Rotorgene 6000 qPCR machine (Qiagen) and analyzed with the Rotor-Gene 6000 software (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on a Rotorgene 6000 qPCR machine (Qiagen) and analyzed with the Rotor-Gene 6000 software (Qiagen) ...
-
bioRxiv - Immunology 2019Quote: ... The aqueous phase/ethanol mixes were then transferred to RNeasy columns and RNA extracted following the RNeasy kit protocol (Qiagen). The experiment was performed three times ...
-
bioRxiv - Plant Biology 2020Quote: ... RT-PCR was performed using the OneStep RT-PCR kit (Qiagen) as per the manufacturer’s instructions ...