Labshake search
Citations for Qiagen :
51 - 100 of 1376 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... The reagents for RT-qPCR include the RNeasy Mini Kit (Qiagen), Power SYBR Green PCR Master Mix and High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was carried out using the SYBR Green I (Qiagen) mix with primers targeted to U2 and U6 snRNA (Supplementary file 2) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reagents for RT-qPCR include the RNeasy Mini Kit (Qiagen), Power SYBR Green PCR Master Mix and High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2022Quote: DNA samples were analyzed by RT-qPCR using QuantiTect SYBR (Qiagen) on a Light Cycler II 480 (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was carried out using the SYBR Green I (Qiagen) mix with primers targeted to U2 and U6 snRNA (Supplementary file 2) ...
-
bioRxiv - Immunology 2022Quote: ... RT-qPCR was conducted in a Rotor-Gene Q system (Qiagen) for over 40 cycles with an annealing temperature of 60 °C ...
-
bioRxiv - Immunology 2023Quote: ... RT qPCR was conducted with custom array plates (330171, Qiagen, Canada) using the LightCycler 480 Real-Time PCR system (Roche Molecular Systems Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR reaction was carried out using the QuantiNova Kit Probe RT-PCR Kit (Qiagen, catalog #208354, Germany), using primers and probe described in Naveca et al ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... 12.5 µL of 2X Quantitect Probe RT-PCR Master Mix (Qiagen), 0.5 µL of Superscript III Reverse Transcriptase (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... A master mix containing 12.5 μL RT2 SYBR® Green qPCR master mix (Qiagen, Netherlands, Cat #330503), 0.25 μL forward primer (100 μM) ...
-
bioRxiv - Biochemistry 2022Quote: ... qPCR was performed with QuantiFast SYBR Green PCR master mix (Qiagen). Primers used for mouse Actb (QT00095242) ...
-
bioRxiv - Molecular Biology 2019Quote: ... qPCR was performed with QuantiTect SYBR Green PCR Master mix (Qiagen) using primer sets designed to target junctional sequence covering RNA of interest and the adaptor sequence ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-qPCR was performed using the QuantiFast SYBR Green PCR kit (Qiagen). The PCR reaction was conducted on a Corbett Rotor-Gene 6000 (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... RT-qPCR was performed with QuantiTect SYBR Green PCR Kit (QIAGEN, Germany) according to the manufacturer’s instruction by CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR reactions were run on a Rotor-Gene Q cycler (Qiagen) in a three-step protocol ...
-
bioRxiv - Genomics 2019Quote: ... and RT-qPCR: RNA extraction was performed using an RNAeasy kit (Qiagen). Reverse transcription was performed using Superscript III (Invitrogen) ...
-
bioRxiv - Physiology 2023Quote: ... RT-qPCR was then performed with QuantiTect SYBR Green PCR Kit (Qiagen) on a LightCycler 480 (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using QuantiNova SYBR Green 1 Step kit (Qiagen) with 40 cycles of amplification at 57ᵒC performed on an ABI 7500 (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2023Quote: ... reaction mixes of 10 µl DNase I (Qiagen 79254) and 1µl (=10U ...
-
bioRxiv - Microbiology 2023Quote: ... A nested RT-PCR (QIAGEN hot start Taq master kit 1000 units) was then performed from 2 µL of previous amplicon for 15 min at 95°C then 35 cycles of amplification (30 sec at 94°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... according to manufacturer’s protocol (MiScript Primer assays and II RT kit for cDNA synthesis and MiScript SYBR Green PCR Kit for RT-qPCR, 218161, Qiagen) from which the recovery of cel-miR-39 spike-in control was confirmed.
-
bioRxiv - Bioengineering 2021Quote: ... One-step reverse transcription quantitative polymerase chain reaction (RT-qPCR) was then performed on extracted RNA samples using a QuantiTect Probe RT-PCR kit (Qiagen) with 7.8 μl purified viral RNA or specified quantities (2.5 ng or 100 ng ...
-
bioRxiv - Neuroscience 2021Quote: Two-step reverse transcription qPCR (RT-qPCR) was performed by first converting total RNA into cDNA via QuantiTect Reverse Transcription Kit (Qiagen). Resulting cDNA was queried for expression of genes of interest and the 18s reference gene via qPCR using TaqMan probes (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... The RNA concentration was measured using Geneflow Nanophotometer and RT-qPCR was performed with one-step QuantiFast SYBR Green qPCR kit (Qiagen) using 50ng of RNA in each sample ...
-
bioRxiv - Immunology 2019Quote: ... The cDNA was mixed with RT2SYBR Green/ROX qPCR Master Mix (Qiagen, Hilden ...
-
bioRxiv - Neuroscience 2019Quote: ... QPCR reactions were performed using QuantiTect SYBR Green PCR Master Mix (Qiagen) and 500 nM primers ...
-
bioRxiv - Microbiology 2022Quote: ... qPCR reactions were carried out using QuantiTect SYBR green master mix (Qiagen) with 200 nM of each primer and 4 μl of cDNA diluted 1/50 in DEPC water ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed with SYBR Green Master Mix (Qiagen, Germantown, MD, USA) using primers ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR master mix was composed of QuantiFast SYBR Green PCR kit (Qiagen) and forward and reverse primers (1 µM ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was performed using the miScript SYBR Green PCR Kit (QIAGEN, 218073) on a step-one plus PCR machine (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCR was performed using QuantiTect SYBR® Green PCR Kit (#204145, QIAGEN) on Agilent MP3005P thermocycler ...
-
bioRxiv - Bioengineering 2021Quote: ... The cDNA was added to RT² SYBR Green ROX qPCR Mastermix (Qiagen 330520) and the solution was added to a Custom RT2 PCR Array 384-well plate and qPCR program was run using QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems 4485701) ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR analyses were performed using QuantiFast SYBR Green RT-PCR Kit (Qiagen, 204154) on StepOne Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2020Quote: ... and for the RT-PCR reaction—RT2 SYBR Green ROX qPCR Matermix (Qiagen). The average Ct values across the three housekeeping genes B2m ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-qPCR was performed subsequently using a QuantiTect SYBR Green PCR Kit (Qiagen). We purchased all primers from Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was performed using a Quanti-Tect SYBR green PCR kit (Qiagen) and primers for the target genes (Table S2) ...
-
bioRxiv - Cell Biology 2019Quote: ... Quantitative RT-qPCR was performed using QuantiTect SYBR®-Green PCR kits (Qiagen) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was conducted by QuantiTect SYBR® Green PCR Kit(204145, QIAGEN) approaches on Agilent MP3005P thermocycler ...
-
bioRxiv - Microbiology 2019Quote: The RT-qPCR was performed on site using a RotorGene 5plex platform (Qiagen). Primers and Taqman dual labelled probes targeting Mtb and the internal control were procured from Eurofin Genomics ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-qPCR was performed using a QuantiTect SYBR® Green PCR kit (Qiagen) and primers for the target genes (Table 2) ...
-
bioRxiv - Biophysics 2023Quote: ... We assembled qPCR reactions with QuantiFast SYBR Green RT-PCR Kit (Qiagen # 204156), gene-specific oligonucleotides (Supplementary Table 14 ...
-
bioRxiv - Cancer Biology 2020Quote: ... at a final concentration of 50 nM and confirmed by RT-qPCR with the miRCURY LNA™ Universal RT microRNA PCR system (Qiagen) and a StepOnePlus thermocycler (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and quantitative RT-PCR was performed using SYBR-based primers (Supplemental Table 1) and RT SYBR Green qPCR Mastermix (Qiagen, #330509) on a CFX96 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Physiology 2023Quote: ... A one-step real-time quantitative polymerase chain reaction (RT-qPCR) was performed using a QuantiFast SYBR Green RT-PCR one-step kit on a Rotorgene 3000Q thermocycler (Qiagen, UK). Each reaction was setup as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-PCR was performed in triplicate using SYBR Green PCR Master Mix (Qiagen) and run on Viia7 platform (Applied Biosystems) ...
-
bioRxiv - Immunology 2019Quote: ... and TNFSF13B transcripts was examined using RT2 SYBR Green qPCR Master Mix (Qiagen), and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Developmental Biology 2024Quote: ... qPCR analysis was performed in triplicate using SYBR green master mix (Qiagen, 204143) on a QuantStudio6 Real-Time PCR System ...
-
bioRxiv - Neuroscience 2019Quote: ... All the qPCR experiments were performed using Quantifast SYBR Green RT-PCR Kit (Qiagen) in a LightCycler 480 II System (Roche) ...
-
bioRxiv - Genomics 2021Quote: ... and quantified by using RT-qPCR with the QuantiTect kit (#204443; Qiagen, Hilden, Germany) in a StepOne ABI Thermocycler ...