Labshake search
Citations for Qiagen :
301 - 350 of 1376 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... We then used the purified RNA samples for RT-PCR with the OneStep RT-PCR kit (cat# 210210, Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... Expression of the genes of interest was also confirmed using RT-PCR using the OneStep RT-PCR Kit (Qiagen) before the experiment was conducted ...
-
bioRxiv - Microbiology 2021Quote: ... and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen) and QuantStudio 5 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed with 200 ng of extracted total RNA using a Qiagen OneStep RT-PCR Kit (Qiagen). The primers used were a forward primer (Hokkaido System Science ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Allele-specific expression was measured using RT-ddPCR with the One-Step RT-ddPCR Advanced Kit for Probes (Qiagen) on a QX200 ddPCR Droplet Reader (BioRad ...
-
bioRxiv - Microbiology 2019Quote: The TopTaq Master Mix Kit (Qiagen) was used for the amplification of all positive HBoV samples following the manufactures instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... using QuantiFast SYBRGreen Master Mix (Qiagen) following the manufacturers recommendations ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 5 μL Qiagen master mix (Qiagen Type-It Microsatellite Kit ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Genomics 2019Quote: ... 25 μl HotStarTaq Master Mix (Qiagen) and 10 pmol of each primer ...
-
bioRxiv - Neuroscience 2022Quote: ... using SYBR-Green Master Mix (Qiagen), with primers for target genes (Malat1 ...
-
bioRxiv - Microbiology 2021Quote: ... Taq PCR Master Mix from Qiagen was used to prepare the PCR master mix ...
-
bioRxiv - Neuroscience 2020Quote: ... HotStarTaq master mix (Qiagen, Hilden, Germany) was used for amplification of 1 μL of the bisulfite-treated DNA modified using the following steps ...
-
bioRxiv - Developmental Biology 2019Quote: ... Quantinova Probe PCR Master Mix (Qiagen) and Assay-on-Demand primer/probe sets (see Table 1 for details) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Cancer Biology 2020Quote: ... The following RT2 qpcr primer assays (Qiagen) were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... in a RotorGene qPCR thermocycler (QIAGEN, Germany) for 40 cycles of 94°C for 20 seconds ...
-
bioRxiv - Immunology 2020Quote: ... Primers used for qPCR: RPS9 (QT00233989, Qiagen) as a reference gene ...
-
bioRxiv - Immunology 2019Quote: ... Pre-designed RT2 qPCR primer assays (Qiagen) were used to determine the expression level of cytokines such as ...
-
bioRxiv - Genomics 2021Quote: ... and real-time qPCR on RotorGene (QIAGEN). Recovered DNA was concentrated ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR was performed on a RotorGeneQ (Qiagen) using SYBR-Green Master Mix (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... PRRSV-2 RNA was used to amplify cDNA encoding the full-length of N gene by RT-PCR (One-step RT-PCR, QIAGEN) using specific primers with the forward containing a T7 promoter sequence at the 5’ end ...
-
bioRxiv - Molecular Biology 2019Quote: Reverse transcription (RT) of total RNA to cDNA was performed in 50 μL reaction volumes using the miRCURY RT kit (Qiagen) and 10 μL total RNA as input ...
-
bioRxiv - Microbiology 2021Quote: ... evidence for successful ACE2 transduction was determined by real-time RT-PCR for mCherry mRNA with the OneStep RT-PCR kit (Qiagen). All samples for mCherry analysis were evaluated in one RT-PCR run ...
-
bioRxiv - Microbiology 2022Quote: ... primer sets were designed based on the Medaka-polished contigs and used for the RT-PCR amplification of regions of interest using the OneStep RT-PCR kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: The cells previously frozen in plates were thawed on ice and RT-PCR was performed using the OneStep RT-PCR kit (Qiagen) protocol without modification ...
-
bioRxiv - Biochemistry 2020Quote: ... Reverse ttranscription (RT) for miRs was completed with 300 ng of total RNA using a miScript II RT Kit (Qiagen) per the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2019Quote: ... Clones were screened for translocations and the cDNA breakpoint determined by RT-PCR in a 96-well AB Veriti Fast Thermal Cycler using the Quantitect SYBR green RT-PCR kit (Qiagen) according to the manufacturers instructions with an annealing temperature of 56°C for 30 seconds ...
-
bioRxiv - Pathology 2021Quote: ... and from lung and/or heart tissues of seropositive rodents were used to amplify viral genome by RT- PCR using the One Step RT-PCR kit (QIAGEN) followed by nested or heminested PCRs (Taq Pegasus ...
-
bioRxiv - Immunology 2020Quote: ... The presence of the desired mutations in the viral genomes was verified by sanger sequencing of RT-PCR amplicons generated with the OneStep RT-PCR-kit (Qiagen) using LCMV WE GP-specific primers (GATTGCGCTTTCCTCTAGATC and TCAGCGTCTTTTCCAGATAG) ...
-
bioRxiv - Microbiology 2022Quote: ... villosum) (Table 1) were used in RT-PCR tests conducted in Slovenia using the OneStepTM RT-PCR kit (Qiagen, USA) as previously described (Rivarez et al ...
-
bioRxiv - Molecular Biology 2023Quote: Quantitative RT-PCR was performed using 30 ng of total RNA and QuantiTecT sYBR Green RT-PCR kit (Qiagen, 204243) according to the supplier’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... was reverse transcribed into cDNA by miScript RT II Kit using miScript HiSpec Buffer or miRCURY LNA RT Kit (Qiagen). Expression levels of miR-142-5p were analyzed using miScript PCR System or miRCURY LNA SYBR Green PCR Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2023Quote: ... Transcript-specific primers were designed to span introns and the spcar3 mutation site and used in one-step RT-PCR reactions (210210, OneStep RT-PCR kit, Qiagen). Primer sequences for qRT-PCR are listed in Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Two μL of isolated RNA were used for reverse transcription (RT) and cDNA synthesis using the miRCURY LNA RT Kit (Qiagen) according to the manufacturer’s instructions adding the RNA spike-in UniSp6 as quality control for RT ...
-
bioRxiv - Microbiology 2020Quote: ... using One Step RT-PCR kit (Qiagen, Germany) and its larger portion was amplified for phylogenetic analysis by self designed primers ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized with Omniscript RT Kit (Qiagen). The relative mRNA expression level of each target gene was quantified by qPCR using KAPA SYBR fast qPCR master mix (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was prepared using Quantitect RT- PCR (Qiagen) and RT Q-PCR was performed using the TaqMan Gene Expression Assay (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... QuantiFast SYBR Green RT-PCR Kit (Qiagen, 204156) was used for the qPCR reaction and measurement performed on the 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... or miRscript RT kit II (Qiagen, Ref. 218161), respectively ...
-
bioRxiv - Immunology 2021Quote: ... reverse transcribed into cDNA (QuantiTect RT kit, Qiagen) and analyzed by RT-qPCR.
-
bioRxiv - Immunology 2021Quote: ... cDNA was prepared using Quantitect RT-PCR (Qiagen) and PCR performed with Brilliant III SYBRGreen on a Stratagene Mx3000 ...
-
bioRxiv - Immunology 2023Quote: ... and Omniscript Reverse Transcription (RT) Kit (Qiagen, #205113) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.45 μL of OneStep RT Mix (Qiagen, Germany), 8.4 μL of HDPCR Mix ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a RT² Profiler PCR Array (Qiagen, 330231), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was synthesized using Sensiscript RT Kit (QIAGEN) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the miRCURY LNA RT Kit (Qiagen, UK) was used to conduct qPCR in the Roche ® LightCycler® 480 according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR analysis of gene expression was undertaken using the KAPA SYBR FAST qPCR kit and the Rotor-Gene Q5Plex qPCR system (Qiagen). Thermal cycling conditions were as follows ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA generated after performing reverse transcription of RNA product was subjected to quantitative PCR (qPCR) analysis using gene-specific predesigned primers (RT2 qPCR Primer Assay, Qiagen), listed in Supplementary Table S4 ...