Labshake search
Citations for Qiagen :
501 - 550 of 5525 citations for Primary Human Brain Microvascular Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Cell Biology 2021Quote: The human VCP cDNA was reverse transcribed from total RNA by using Omniscript RT kit (Qiagen Japan, Tokyo, Japan) extracted from A549 cells (RIKEN Cell Bank ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA targets were only included if biochemically confirmed using human tissue or non-species specific methods (sourced from QIAGEN’s curated Ingenuity Knowledge Base[48] ...
-
bioRxiv - Immunology 2021Quote: ... followed by amplification and quantification using RT2 Profiler Human Innate and Adaptive Immune Response 96-well Array (Qiagen, 330231) with RT2 SYBR Green ROX qPCR Mastermix (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: Bacterial DNA was extracted from human and mouse feces-derived bacterial supernatant using the DNeasy powersoil kit (Qiagen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... or postmortem human cerebellar vermis samples using either the RNeasy Kit or RNeasy Fibrous Tissue Kit following the manufacturer’s protocols (QIAGEN). For tissue RNA extraction ...
-
bioRxiv - Cancer Biology 2022Quote: ... The sequenced reads were mapped with the hg38 human genome and sequence analysis was done by the CLC genomics workbench (12.0.3, Qiagen Bioinformatics). Additionally ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from both NHP and human stool samples using the PowerFecal DNA Isolation Kit (Qiagen, Valencia, CA). Sequencing of the 16s small subunit ribosomal ribonucleic acid (SSU rRNA ...
-
bioRxiv - Microbiology 2023Quote: Total genomic DNA was extracted from human tissue and cyst fluid using the QIAamp Mini kit (Qiagen, Hilden, Germany). Extractions were performed per manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Raw FASTQ reads were aligned to the GRCh38 human genome using CLC Genomics Workbench version 22.0.2 software (Qiagen, USA). Differential gene expression was determined using the built-in tool in CLC Genomics workbench ...
-
bioRxiv - Physiology 2024Quote: RNA was extracted from human tissue derived organoids and neutrophils using the RNeasy® Plus Mini Kit (Qiagen, #74104) with cDNA prepared using a SuperScript™ VILO™ cDNA synthesis kit (Invitrogen ...
-
bioRxiv - Synthetic Biology 2020Quote: ... For SARS-CoV-2 antigen detection the blots were incubated with 1:2000 Anti-His mouse monoclonal primary antibody (Qiagen, #34660) and then incubated with 1:10000 peroxidase labelled anti-mouse IgG secondary antibody (GE Healthcare) ...
-
bioRxiv - Genomics 2020Quote: BAC clones were extracted from each of these primary pools using either the Qiagen Large-construct Kit (10) (12462, Qiagen, Germany) or Omega BAC/PAC DNA Maxi Kit (D2154-02 ...
-
bioRxiv - Physiology 2023Quote: Whole adipose tissue or isolated primary adipocytes and aorta were mechanically homogenised with 5mm stainless steel beads using a TissueLyser II system (Qiagen, UK) in the presence of 700μL QIAzol Lysis Reagent (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was extracted from the paired primary-recurrent frozen tumor samples using the RNA Mini Kit according to the manufacturer’s protocol (Qiagen; Germantown, MD). Nucleic acid concentration and purity were assessed using a NanoDropTM 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA (200 ng) was used for quantitative PCR with the Human Cellular Senescence RT2 Profiler™ PCR Array (Qiagen) containing 84 key genes involved in the initiation and progression of the biological process causing cells to lose the ability to divide ...
-
bioRxiv - Molecular Biology 2019Quote: Preliminary screening for the presence of serum exosomal miRNAs was determined using a miScript human miFinder PCR array (MIHS-001Z, Qiagen). RNA was converted to cDNA using miScript RT kit (218060) ...
-
bioRxiv - Genetics 2020Quote: ... Analyses of HTT CAG repeat size in both HttQ111 mice and in patient fibroblasts was performed by PCR using human-specific HTT primers and Taq PCR Core Kit with Q solution (Qiagen), as previously described (17 ...
-
bioRxiv - Bioengineering 2020Quote: ... The prepared cDNA was preamplified using the RT2 PreAMP Primer Mix for Human and Mouse PCR Array (Qiagen, PBH-181Z). cDNA was analyzed by RT-qPCR using a Qiagen RT2 profiler custom panel (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: Total RNA of 1-2 x 106 human macrophages (2-4 biological replicates/ macrophage donors per condition, see Table S17) was isolated using RNeasy extraction kit (Qiagen) including DNAse treatment according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Synthetized cDNA was subjected to a PCR array specific for the human antiviral response (RT² Profiler PCR array – PAHS-122Z, SA Biosciences, Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... was used for human ISG15 and ISG56 and mouse genes including Gapdh as the housekeeping gene on the Rotor-Gene Q 5plex (Qiagen). RT-qPCR primers and probes are listed in the supplementary table 2.
-
bioRxiv - Microbiology 2021Quote: ... mRNA-Seq FASTQ reads were mapped to the human reference genome (Homo sapiens v81; hg38) using default options on CLC Genomics Workbench 11 (Qiagen). Total gene reads (with at least 1 read count ...
-
bioRxiv - Genomics 2020Quote: RNA isolation for all the 248 human subjects were performed using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The isolated RNA was subjected to qPCR for determining viral load by Ct values ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from human fibroblasts as well as iNs from the same lines using the miRNeasy kit (Qiagen) followed by Universal cDNA synthesis kit (Fermentas) ...
-
bioRxiv - Cancer Biology 2021Quote: RNA/DNA was isolated from the macro-dissected xenografts (injected/contralateral side, separately) and human GBM (AllPrep DNA/RNA Mini Kit, Qiagen). The ratio of human/mouse cells in the xenografts was estimated by species specific PCR (DNA ...
-
bioRxiv - Microbiology 2022Quote: ... Initial gene expression profiling was performed using the 96-well Human Cytokines & Chemokines RT2 Profiler PCR Array (PAHS-150ZC, Qiagen) according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2020Quote: Total DNA samples were obtained from human skin biopsy samples (XX, caucasian, 79 yr) using the QIAamp DNA Mini Kit (Qiagen) and applied to the human Illumina Infinium EPIC 850K chip ...
-
bioRxiv - Microbiology 2021Quote: ... RNA-seq FASTQ data were processed and mapped to the human reference genome (hg38) with the CLC Genomics Workbench 20 (Qiagen). Differential gene expression was analyzed with the DESeq2 package in R (Drummond et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen, Catalog#:PAHS-019ZA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: RNA from human M1 macrophages transfected with SP140 siRNA or scrambled siRNA was extracted using a RNeasy mini-kit (Qiagen). 150 ng total RNA was labelled using the cRNA labelling kit for Illumina BeadArrays (Ambion ...
-
bioRxiv - Genomics 2022Quote: ... RNA was also extracted from human first and second trimester placental villi using the RNeasy Plus Universal Mini Kit (Qiagen). Libraries were made using the Illumina TruSeq Stranded mRNA Library Kit according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... We designed species specific MALAT1 tiling primers for human and green monkey (Table S1) and performed multiplex PCRs following Qiagen Multiplex PCR protocol (Qiagen). cDNA was divided equally between primer sets ...
-
bioRxiv - Microbiology 2023Quote: ... Human macrophages were lysed in 350 μL RLT buffer with β-mercaptoethanol and centrifuged through a QIAshredder spin column (Qiagen). cDNA was synthesized from isolated RNA using SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Physiology 2023Quote: ... total RNA from normal human or AIL patient neutrophils was isolated using RNeasy Total RNA Isolation Kit (Qiagen, GmBH, Germany)/ TRIzol reagent (Life technologies ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from whole lungs from IAV non-infected / infected mice and human PBMCs using (RNeasy mini kit, Qiagen). RNA quantity and purity were assessed using a spectrophotometer (NanoDrop) ...
-
bioRxiv - Cell Biology 2024Quote: ... The melting curves of amplified product DNA fragments were quantified against the methylation standard curve generated using commercial bisulfite converted human genomic DNAs (Qiagen) and expressed as a mean methylation percentage.
-
bioRxiv - Microbiology 2024Quote: ... with ReadyMade PrimeTime primers for SPI1 (Integrated DNA Technologies Inc, USA) and RT2 qPCR Primer Assay for Human GAPDH (cat# PPH00150F-200, Qiagen). Expression was quantified using ABI Sequence Detection software compared to serial dilutions of an SPI1 or GAPDH synthetic sequence gBlock (Integrated DNA Technologies Inc ...
-
bioRxiv - Cancer Biology 2021Quote: Snap frozen primary tumors were prepared for RNA isolation by TRIZOL digestion and subsequent homogenization using a TissueLyser II (Qiagen, Hilden, Germany) with a 5 mm stainless steel bead for 2 min at 30 Hz ...
-
bioRxiv - Cancer Biology 2023Quote: ... primary prostate tumor tissue cores (three 20 µm-thick, unstained FFPE sections per patient) using the Rneasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was extracted from primary solution with the removal of genomic DNA by the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany). The purity and concentration of extrasted totel RNA were confirmed using a NanoDrop ONE spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human U6 primer used in this experiment was included in the miScript Primer assay kit (Qiagen Inc., Germantown, MD, #218300).
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was isolated from a 23 week human fetal heart using Trizol-based dissociation followed by the RNEasy Mini Kit (Qiagen #74104). cDNA was created from this RNA using the iScript Reverse Transcription Supermix (Bio-Rad #1708840) ...
-
bioRxiv - Systems Biology 2022Quote: DNA was isolated from human buffy coat samples at the Crimson Core facility (Mass General Brigham) using the QIAamp DNA Blood Mini Kit (Qiagen 69504) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Reference plasmids were serially diluted in either PBS buffer or heat-inactivated normal human serum (NHS) and re-extracted using the QIAamp® DNA Blood Mini Kit (Qiagen) per recommended protocol for serum ...