Labshake search
Citations for Qiagen :
301 - 350 of 1466 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: Quantitative real-time PCR (RT-qPCR) assays were performed using SYBR Green qRT-PCR master mix (QuantiNova SYBR Green PCR Kit, Qiagen) with primers designed using the Primer3 software (primer3.ut.ee ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated as previously described.8 The cDNA and purified viral DNA were used for quantitative PCR (qPCR) using QuantiTect probe PCR master mix (Qiagen) and optimized concentrations of forward primer (TGTGTGGGAGACCATCAAGC) ...
-
bioRxiv - Microbiology 2023Quote: ... The primers were used in a 28 cycle PCR with the HotStarTaq Plus Master Mix Kit (Qiagen Inc., Hilden, Germany). The PCR cycle conditions were as follows ...
-
bioRxiv - Genetics 2023Quote: ... Amplicons spanning the gRNA target sites were amplified from 1 μL of purified gDNA using HotStar PCR Master Mix (Qiagen). Half of each reaction was run on a 1.5% agarose gel ...
-
bioRxiv - Plant Biology 2023Quote: ... assays were performed with triplicates of cDNA aliquots in 96-wells reaction plates using Quantinova qPCR SYBR Green Master Mix (QIAGEN) according to the manufacturer’s manual ...
-
bioRxiv - Microbiology 2023Quote: ... Triplicate PCRs were carried out in 15 µl reactions containing 1x UCP Multiplex PCR Master Mix (Qiagen, Venlo, The Netherlands), 0.3 μmol l−1 each of the forward and reverse primers ...
-
bioRxiv - Immunology 2023Quote: ... cDNAs were synthesized using High Capacity RNA-to-cDNA kit (ThermoFischer Scientific) and quantitative RT-PCR were carried out using specific primers (Table S2) and SYBR Green PCR Master Mix (Qiagen). PCR amplification of Gapdh was performed to control for sample loading and normalization between samples ...
-
bioRxiv - Microbiology 2024Quote: ... transposon junctions were amplified by using a transposon-specific primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and a primer P7 (CAAGCAGAAGACGGCATACGAGAT) using the HotStarTaq master mix kit (Qiagen). The himar1-enriched samples were diluted in a ratio of 1:50 ...
-
bioRxiv - Microbiology 2024Quote: ... amplification was carried out using a p5 indexing primer comprising the sequence AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC (where [i5] denotes the barcode sequence) and a P7 primer in combination with the HotStarTaq master mix kit from Qiagen. This process added unique barcodes as well as the necessary P5 and P7 flow cell adapter sites required for Illumina sequencing ...
-
bioRxiv - Immunology 2024Quote: ... 1 μl of the first round PCR product was used as a template for the second nested PCR reaction using HotStartTaq Master Mix Kit (QIAGEN). The cycling conditions for the second PCR reaction were 95°C for 5 min ...
-
bioRxiv - Immunology 2024Quote: ... cDNA was diluted to 5 ng/µl in RNase-free water and 1 µl used for real-time qPCR with Qiagen QuantiNova SYBR Green Master Mix (Qiagen) in a StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: ... 1 μl of second round PCR product as the template in a new 14 μl reaction using HotStartTaq Master Mix Kit (QIAGEN). Each well was barcoded ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse transcription was executed with SuperScript IV VILO Master mix by following the instructions of the manufacturer and subsequently cleaned with DNeasy blood and tissue kit (Qiagen) by only following step 3-8 in the instructions from the manufacturer ...
-
bioRxiv - Systems Biology 2021Quote: ... and added 10uL 2x TCL buffer (Qiagen) to each well before freezing at −80C.
-
bioRxiv - Bioengineering 2020Quote: ... A Qiagen RT2 SYBR Green master mix with validated qPCR human primers (for HUVECs and BeWo) or mouse primers (for N27 cells) from Qiagen (Frederick) were used to determine relative magnitudes of gene-expression levels using RT-PCR ...
-
bioRxiv - Immunology 2020Quote: ... The remaining pellet was used as the PCR template for each of the sorted samples and amplified using the Taq PCR Master Mix Kit (Qiagen, 201443) and sample-specific forward primer (serving as sample identifier ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA gene V4 variable region PCR primers 515/806 were used in a single-step 30 cycle PCR using the HotStarTaq Plus Master Mix Kit (Qiagen, USA) under the following conditions ...
-
bioRxiv - Plant Biology 2023Quote: PCR primers 515/806 with barcoding on the forward primer were used in a 28 cycle PCR (5 cycle used on PCR products) using the HotStar Taq Plus Master Mix Kit (Qiagen, USA) to target the 16S rRNA gene for region V3 and V4 ...
-
bioRxiv - Neuroscience 2023Quote: RNA from cultured GCs was isolated using RNeasy Micro Kit (Qiagen #74004) with on-column DNA digestion ...
-
bioRxiv - Microbiology 2019Quote: ... the V4 region of the bacterial 16S rRNA was amplified using the Hot Start Taq Plus Master Mix (Qiagen, Germantown, MD, USA) and indexed primers [52] ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative real-time PCR (qPCR) analysis was performed on an Applied Biosystems Real-Time PCR Systems using SYBR Green Master Mix (Qiagen, MD, USA). The thermal cycler conditions were as following ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μL of fecal DNA from each mouse was used as template in 25 μL total reactions of SYBR Green Real Time PCR Master Mix as instructed by the manufacturer (Qiagen; Hilden, Germany). Reactions were carried using CFX Connect Real Time PCR Detection System (BioRad ...
-
Role of autophagy in sepsis-induced skeletal muscle dysfunction, whole-body metabolism, and survivalbioRxiv - Cell Biology 2021Quote: ... Each primer (3.5 μl) was combined with reverse-transcriptase reagent (1 μl) and SYBR® Green master mix (25 μl) (Qiagen, Valencia, CA). The thermal profile was as follows ...
-
bioRxiv - Genetics 2022Quote: ... The PCR amplification was carried out in a 10-μl reaction volume containing 8 μl of Taq PCR Master Mix (Qiagen, Hilden, Germany), 10 μM of each primer (1 μl) ...
-
bioRxiv - Epidemiology 2019Quote: The PCR amplification mixtures used for RD9 deletions were as follows: reactions were performed in a total volume of 20 μl consisting of 10 μl HotStarTaq Master Mix (Qiagen, United Kingdom), 7.1 μl distilled H2O ...
-
bioRxiv - Microbiology 2023Quote: Each PCR amplification method was performed in a 25 µl reaction volume using HotStar Taq Plus Master Mix kit (Qiagen, Hilden, Germany). Details of primers used in this study are given in the Table 1.
-
bioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instruction and the resulting cDNA was used for reverse transcription-polymerase chain reaction (RT-PCR) using HotStarTaq Plus Master Mix Kit (Qiagen, Germantown, MD). The PCR conditions used were as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... GCs were sorted directly into the RLT lysis buffer (QIAGEN Allprep Mini Kit) for total RNA extraction.
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of 20 mM of each primer (KAN-2 FP1 or KAN-2 RP1 complementary to the Tn5 sequence with the bubble primer 224) and 10 μL of the 10X Qiagen Multiplex PCR Master Mix Kit (Qiagen, Valencia, CA, USA) in a final volume of 100 μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... the total reaction volume of 25 µl per sample included 12.5 µl TaqMan® qPCR master mix (QuantiTect® Multiplex PCR NoROX Kit (QIAGEN, Hilden, Germany), 1.25 µl of the respective primer/probe mix (Table 2 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... All of the real-time PCR reactions were performed with RT2 SYBR Green/ROX PCR Master Mix (Cat# 330503, Qiagen, Valencia, CA, USA) and relative mRNA expression of each gene was determined using CFX96 real-time system (Bio-Rad ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR mixture contained 0.2 μM of each primer and 40 ng of bacterial DNA in a total volume of 100 μL (HotStar Taq Master Mix Kit, Qiagen, Valencia, CA, USA) (60).
-
bioRxiv - Physiology 2023Quote: ... and IFNγ mRNA was performed on the StepOne Plus Real Time PCR System instrument using the QuantiTect SYBR Green PCR Master Mix (Qiagen, Cat No: 204143). The primers are presented in the Supplemental Materials (Table S2) ...
-
bioRxiv - Bioengineering 2020Quote: ... This mixture was diluted 2x into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 minutes followed by heat-inactivation at 95°C for 2 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... The column was washed with 2x Buffer RLT (Qiagen) and purified RNA eluted in 30µL of RNAse free H20 ...
-
bioRxiv - Neuroscience 2023Quote: ... fluorescently labeled GC particles were collected in RLT (Allprep DNA/RNA Micro Kit #80284, Qiagen) supplemented with 10% b-Mercaptoethanol.
-
bioRxiv - Microbiology 2019Quote: ... TissueLyser II (Qiagen) was further used to break heterocysts at frequency of 30/s for 8 min ...
-
bioRxiv - Immunology 2021Quote: ... qPCR was performed using 2x QuantiNova Probe Mastermix (Qiagen, USA) on the Bio-Rad CFX96 Touch™ Real Time PCR Detection system ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2x Elution buffer (Qiagen, 10 mM Tris-Cl, pH 8.5), 1x rCutsmart Buffer.
-
bioRxiv - Neuroscience 2023Quote: ... water (5.5 μL) and 2x SYBR green (10μL, QIAGEN, Cat #330520) per 20μL reaction ...
-
bioRxiv - Microbiology 2019Quote: ... The TissueLyser II (QIAGEN) was set to 30 hz/sec for a total of 15 mins for the pools of whole mosquito samples ...
-
bioRxiv - Molecular Biology 2020Quote: ... using TissueLyser II (Qiagen). Quantification of total protein concentration was assessed by the bicinchoninic acid (BCA ...
-
bioRxiv - Cell Biology 2021Quote: ... and Tissuelyser II (Qiagen). Total RNA were extracted from roots 5 days after germination using the RNeasy® Plant Mini kit (Qiagen #74904 ...
-
bioRxiv - Cell Biology 2021Quote: ... using TissueLyzer II (Qiagen) for 30 min ...
-
bioRxiv - Synthetic Biology 2021Quote: ... using TissueLyser II (Qiagen) at 25Hz for 2mins ...
-
bioRxiv - Synthetic Biology 2021Quote: ... using TissueLyser II (Qiagen) at 25Hz for 2mins ...
-
bioRxiv - Cancer Biology 2023Quote: ... using TissueLyser II (Qiagen) homogenizer at 4°C following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... using Tissuelyser II (Qiagen) and steel beads of 5 mm diameter ...
-
bioRxiv - Immunology 2021Quote: ... The sorted cells were deep frozen in 2x TCL buffer plus (Qiagen) plus 1% beta-mercaptoethanol.
-
bioRxiv - Immunology 2023Quote: ... The sorted cells were deep frozen in 2x TCL buffer plus (Qiagen) plus 1% beta-mercaptoethanol.