Labshake search
Citations for Qiagen :
201 - 250 of 1466 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... and 5 μl of QuantiFast SYBR Green RT-PCR Master Mix (Qiagen, Manchester, UK). Reverse transcription was initiated with a hold at 50°C for 10 minutes (cDNA synthesis ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR was performed on the genomic DNA using Taq PCR Master Mix from Qiagen and BAP1 intron 3 Fw and BAP1 intron 4 Rv ...
-
bioRxiv - Developmental Biology 2022Quote: qPCRs were performed using the QuantiTectTM SYBR® Green PCR Master mix (QIAGEN, 204143) and ran on a Bio-Rad CFX96 system.
-
bioRxiv - Physiology 2023Quote: ... and 5 μl of QuantiFast SYBR Green RT-PCR Master Mix (Qiagen, Manchester, UK). Each sample was analysed in duplicate ...
-
bioRxiv - Zoology 2023Quote: ... target sites were PCR amplified (using the Taq PCR Master Mix produced by Qiagen), and candidate mutations were identified using Sanger sequencing (performed by Azenta Life Sciences) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... target sites were PCR amplified (using the Taq PCR Master Mix produced by Qiagen), and candidate mutations were identified using Sanger sequencing (performed by Azenta Life Sciences) ...
-
bioRxiv - Microbiology 2024Quote: Mouse cDNA was amplified with gene-specific primers and HotStarTaq Master Mix Kit (Qiagen) (Table 1) ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR amplification was done with Qiagen’s HotStarTaq Master Mix Kit (Qiagen, Cat. No. 203443), with 20 ng of converted DNA and 0.2 µM for each of primers in 30 µL final volume ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse thyroid tissue was homogenized in buffer RLT using TissueLyser II (Qiagen; 2x 2 min cycles at 30 Hz) and 5 mm stainless steel beads ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mouse thyroid tissue was homogenized in buffer RLT using TissueLyser II (Qiagen; 2x 2 min cycles at 30 Hz) and 5 mm stainless steel beads ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...
-
bioRxiv - Genetics 2023Quote: ... amplifications were performed in reaction volumes of 25 μL using a reaction mix containing 1x Type-it Multiplex PCR Master Mix (Qiagen, Gmbh, Hilden), 0.2 μM of each forward and reverse primer pair ...
-
bioRxiv - Immunology 2021Quote: ... and quantitative real-time PCR was performed using SYBR Green PCR Kit Master Mix (Qiagen) and the LightCycler®480 System (Roche ...
-
bioRxiv - Genetics 2019Quote: ... 4 μl of PCR products were subsequently added to 21 μl PyroMark Master Mix (Qiagen) containing 10 pmol of barcoded primers (adapted from NEXTflexTM 16S V1-V3 Amplicon Seq Kit ...
-
bioRxiv - Genomics 2020Quote: ... 4 μl of pooled products were subsequently added to 21 μl PyroMark Master Mix (Qiagen) containing 10 pmol of barcoded primers (adapted from NEXTflexTM 16S V1-V3 Amplicon Seq Kit ...
-
bioRxiv - Microbiology 2021Quote: ... A 28 cycle PCR was performed using the HotStarTaq Plus Master Mix Kit (Qiagen, USA) under the following conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... using miRCURY LNA SYBR Green PCR Master Mix and miRCURY LNA miRNA PCR primers (Qiagen). All protocols were performed according to the manufacturers’ instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were conducted using the HotStarTaq Plus Master Mix Kit (Qiagen, Valencia, CA, USA) and barcoded forward primers ...
-
bioRxiv - Genetics 2021Quote: ... The reagents used were from the Type-it Microsatellite PCR Kit from QIAGEN in a total volume of 10 μl: 2.5 μl master mix (Type-it Kit, QIAGEN), 0.2 μl Q (Type-it Kit ...
-
bioRxiv - Neuroscience 2019Quote: ... and miRCury LNA SYBR Green master mix (cat. #339346) were purchased from Qiagen (Germantown, MD). Ethyl alcohol (190 proof ...
-
bioRxiv - Microbiology 2021Quote: ... a total of 20 μl PCR solution was mixed with 10μl HotStartTaq Master Mix (Qiagen, containing 1 unit of HotStartTaq DNA Polymerase ...
-
bioRxiv - Microbiology 2020Quote: ... The prepared DNA was amplified using the HotStarTaq® Master Mix Kit (Qiagen, Hilden, Germany) and a mix of oligonucleotides and DNA probes labelled with different dyes ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR was performed using the HotStar Taq Plus Master Mix Kit (Qiagen Inc, Texas, USA) under the following conditions ...
-
bioRxiv - Bioengineering 2022Quote: ... Custom RT² Profiler PCR Arrays and SYBR® Green PCR Master Mix (Qiagen, Hilden, Germany) were used to detect expression of transcripts ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative reverse transcription PCR (qRT–PCR) was carried out using SYBR Green Master Mix (Qiagen) on CFX384 system (Bio-Rad) ...
-
bioRxiv - Physiology 2024Quote: ... RT-qPCR reactions were carried out in triplicate with QuantiFast SYBR Green Master Mix (Qiagen) at an annealing temperature of 60ºC ...
-
bioRxiv - Immunology 2024Quote: ... A third round of PCR was performed with HotStar Taq DNA polymerase master mix (Qiagen) using primers with barcodes specific to the plate number and well location as well as adapters appropriate for sequencing on an Illumina MiSeq.
-
bioRxiv - Neuroscience 2024Quote: ... with 0.9 x tissue mass of lysis buffer (1x RIPA buffer with 2% SDS and 2x protease inhibitor cocktail) and TissueRuptor II (Qiagen) homogenization ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 mg of frozen brain was taken per mouse sample and lysed with 0.9 x tissue mass of lysis buffer (1x RIPA buffer with 2% SDS and 2x protease inhibitor cocktail) and was homogenised using a TissueRuptor II (Qiagen). Zebrafish larvae were similarly extracted ...
-
bioRxiv - Plant Biology 2020Quote: ... QPCRs were run using the recommended protocol for 2x ProPlant SYBR Mix (Procomcure Biotech) on a Rotor-Gene Q (Qiagen). Technical triplicates were performed for each biological replicate ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The RNA (2μg) was used for cDNA synthesis using reverse transcription master Mix (QIAGEN, California, USA). RT-qPCR was performed in SYBR Green PCR Master Mix (QIAGEN ...
-
bioRxiv - Genetics 2020Quote: ... Conditions for a 25 μl PCR reaction using the 1 × Taq PCR Master Mix kit (Qiagen) were ...
-
bioRxiv - Cell Biology 2022Quote: ... which was performed using 500 ng of cDNA with QuantiTect SYBR Green PCR Master Mix (Qiagen) in an iCycler IQ real-time PCR detection system ...
-
bioRxiv - Immunology 2022Quote: ... Each 25 µL qPCR reaction contained 12.5 µL of 2× QuantiTect Probe PCR Master Mix (QIAGEN), 600nM of each primer ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR mixture contained 1x master mix for the Type-it Microsatellite PCR Kit (Qiagen, France), 3 µL of Q-Solution and 0.25 µM of each primer in a total volume of 30 µL ...
-
bioRxiv - Immunology 2022Quote: ... Real time qPCR was performed using SYBR green master mix in a Rotor-Gene Q (Qiagen) for analysis of mRNA expression ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR was performed on an Applied Biosystems 7500 machine using QuantiTect SYBR green master mix (Qiagen) in 10ul reaction mixture volumes with 6.25 pmol each of primers Ehd-239F–Ehd-88R ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplification was conducted using the HotStarTaq Plus Master Mix Kit (Qiagen Inc., Germantown, MD, USA). After amplification ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA samples were prepared with the QuantiFast SYBR Green PCR Master Mix reagent (Qiagen, Hilden, Germany) with the detection primers (BEFV-G F ...
-
bioRxiv - Neuroscience 2022Quote: ... each pre-amplified sample was mixed with SYBR® Green ROX qPCR master mix (Qiagen, Inc.), and 25 μl of this preparation was added into each well of the PCR array plate ...
-
bioRxiv - Cancer Biology 2023Quote: Each qPCR reaction consisted of 5 μL of 2× QuantiNOVA SYBR Green PCR master mix (Qiagen), 0.5 μL of 10 μM forward and reverse primers each ...
-
bioRxiv - Developmental Biology 2021Quote: ... 500 nM of each primer and 5 µl of SYBR Green QuantiFast RT-qPCR master mix (Qiagen). Primers used were ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We performed PCR in a 10 µL volume containing 1x multiplex PCR master mix (Qiagen Hilden, Germany), 5-20 ng of genomic DNA ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μl diluted cDNA (1:20) were added to SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) and 10 μM of both forward and reverse primer (Primer Sequences Table 1) ...
-
bioRxiv - Microbiology 2021Quote: ... Transposon junctions were amplified by using a transposon specific primer Mariner_1R_TnSeq_noMm (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and P7 (CAAGCAGAAGACGGCATACGAGAT) primers with HotStarTaq Master Mix Kit (Qiagen). The following PCR condition was used ...
-
bioRxiv - Neuroscience 2020Quote: ... Amplification of 50 ng of cDNA was performed with the QuantiFast SYBR Green PCR Master Mix (Qiagen) with a StepOnePlus RealTime PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2019Quote: ... Several rounds of PCR amplification with the PCR Primer Cocktail and PCR Master Mix (Qiagen, Duesseldorf, Germany) were performed to enrich the adapter-ligated DNA fragments ...
-
bioRxiv - Immunology 2019Quote: ... First round PCR products were produced using 2.5 μl of cDNA and Hotstart Taq Master mix (Qiagen) for 50 cycles using the first-round primers as reported previously (13) ...
-
bioRxiv - Microbiology 2019Quote: ... Transposon junctions were amplified by using a transposon specific primer Mariner_1R_TnSeq_noMm (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and p7 primers (CAAGCAGAAGACGGCATACGAG) with HotStarTaq Master Mix Kit (Qiagen) with the following PCR condition (94 °C for 3 min ...