Labshake search
Citations for Qiagen :
251 - 300 of 1466 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... and real time quantitative PCR was carried out using SYBR Green Real Time PCR master mix (Qiagen). Normalization of target genes were done against TATA-box-binding protein (TBP ...
-
bioRxiv - Plant Biology 2022Quote: All PCR reactions were performed with the 5-Prime Hot Master Mix (Quantabio, QIAGEN, Beverly, MA, U.S.A.). All PCR products and pooled library were purified with CleanNGS beads (CleanNA ...
-
bioRxiv - Plant Biology 2023Quote: ... All PCR reactions were performed in 50µl volume containing: 25µl of Taq PCR Master Mix (QIAGEN, Germany), 2.5µl of BSA (0.2 μg/μL) ...
-
bioRxiv - Microbiology 2022Quote: ... Amplifications were performed in 25 μL reactions with Qiagen HotStar Taq master mix (Qiagen Inc, Valencia, California), 1μL of each 5 μM primers ...
-
bioRxiv - Genomics 2023Quote: The PCR was performed with the Multiplex PCR Kit (Type-It Microsatellite master mix; Qiagen, Hilden, Germany). The SSR primer mix consisted of eight primers (see Table 2 and Table 3) ...
-
bioRxiv - Zoology 2023Quote: ... A PCR was performed on genomic DNA samples using the AllTaqTM Master Mix Kit (Qiagen; cat. #203146) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... PCRs for DH31 and DH31R alleles were conducted using the Taq PCR Master Mix Kit (Qiagen, # 201445) and all primers were synthesized by Microsynth (Balgach ...
-
bioRxiv - Microbiology 2023Quote: Mouse cDNA was amplified with gene-specific primers (see below) and a HotStarTaq Master Mix Kit (Qiagen). Amplicons were cloned and inserted into a pGEM-T vector (Promega ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... rotundus DNA samples (S2 Table) using the HotStarTaq® Master Mix Kit (Qiagen® Valencia, CA, USA) and primers described by Martins et al [51] at 0.2 µM each ...
-
bioRxiv - Genetics 2021Quote: ... Tungsten beads (2x 3mm, Qiagen) were added to each sample and homogenized in a Tissuelyser II (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... The DNA obtained after de-crosslinking and purification was PCR amplified by TopTaq DNA polymerase master mix (Qiagen), using the appropriate set of primers and run on a 2% agarose gel for visualization ...
-
bioRxiv - Microbiology 2021Quote: ... IL-6 and β-actin cDNA were determined by QuantiFast SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) at the conditions ...
-
bioRxiv - Microbiology 2023Quote: ... Each of 50 µl PCR reaction was prepared with instructions from the TopTaq Master Mix Kit (Qiagen, Germany). The amplification profiles and primers were described previously [8,18] ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl of diluted cDNA template was mixed with 4 μl QuantiTect SYBR Green PCR Master Mix (Qiagen), 100 nM forward primers (see Table 1 for sequences ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR amplification was conducted using the HotStarTaq Plus Master Mix Kit (Qiagen Inc., Germantown, MD, United States). After amplification ...
-
bioRxiv - Bioengineering 2024Quote: ... and qPCR reactions were performed using QuantiFast Multiplex PCR Master Mix (w/o ROX) (Qiagen, Redwood City, CA). Each biological replicate was assessed in technical quadruplicate on a 384-well CFX real-time qPCR instrument (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... qPCR was performed on cDNA dilutions of 1/20 in the presence of 7.5-pmol primers with QuantiTect SYBR Green PCR Master Mix (Qiagen) on a Lightcycler 480 (Roche) ...
-
bioRxiv - Plant Biology 2020Quote: ... the reaction mixture in a total volume of 20 μL contained 5.2 μL of PCR Master Mix (components from QIAGEN Corporation ...
-
bioRxiv - Microbiology 2020Quote: ... two multiplex PCRs were carried out in a final volume of 12.5 μL containing 6.25 μL of the Qiagen Multiplex PCR master mix (Qiagen, France), 1 μL of DNA template ...
-
bioRxiv - Genetics 2022Quote: ... 10 ng of each sample (technical triplicates of 3 independent biological replicates) was amplified using various primers (0.5 µM; Table S2) and SYBR Green PCR master mix (QIAGEN). Reactions were run for 44 cycles on a StepOnePlus Real-Time PCR machine (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... Real-time PCR was performed using RT2 Profiler PCR array in combination with RT2 SYBR green master mix (Qiagen) using a QuantStudio 6 Flex real-time PCR system ...
-
bioRxiv - Genetics 2020Quote: ... AC7594-5’-CCGCCTATCCTCGTCATGAAC)andcontrolALG9primers(AC5067-5’-CACGGATAGTGGCTTTGGTGAACAATTAC;AC5068-5’-TATGATTATCTGGCAGCAGGAAA GAACTTGGG) (0.5 µM) and QuantiTect SYBR Green PCR master mix (Qiagen) on a StepOnePlus Real-Time PCR machine (Applied Biosystems ...
-
bioRxiv - Plant Biology 2019Quote: ... The multiplex TaqMan qPCR reaction was carried out in 25 μl reaction mixture containing 12.5 μl of Rotor-Gene Multiplex PCR Master Mix (Qiagen), 2 μl of the primer mix (5 µmol l−1 each) ...
-
bioRxiv - Neuroscience 2021Quote: ... SYBR green RT-qPCR was performed in triplicate with 10 ng of template cDNA using QuantiTect Master Mix (Qiagen) on a 7900-HT Fast Real-time System (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCR amplification was performed in a total volume of 25 µl containing 12.5 µl of Taq PCR Master Mix (Qiagen), 2.5 µl of each primer (10 mM ...
-
bioRxiv - Plant Biology 2022Quote: ... RT–qPCR was prepared using the standard protocol of “QuantiNova SYBR Green PCR Master Mix (QIAGEN, Pudong, Shanghai, China)” ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV2 subgenomic viral RNA was quantified using primer probe sets as previously described (Wölfel et al., 2020) and Quantifast One-Step RT-PCR master mix (Qiagen) on a QuantStudio 3 or 5 instrument (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR was performed using genomic DNA isolated from tumors as the template using HotStarTaq Plus Master Mix Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... VDAC1P8-201 and GAPDH (Suppl. Table 5) and 12.5 μl of master mix (QuantiFast SYBR Green PCR kit, Qiagen). Analysis of relative expression level was performed using the housekeeping GAPDH gene as internal calibrator by the ΔΔCt method ...
-
bioRxiv - Bioengineering 2023Quote: ... was used as the master mix while the qPCR was performed using a RotorGene® (Qiagen N.V., Germany, Hilden). Before sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... The amplification was performed in a 25 μl reaction volume containing 12.5 μl of Rotor-Gene Multiplex PCR Master Mix (Qiagen), 2 μl of the primer mix (5 µM each primer concentration ...
-
bioRxiv - Immunology 2024Quote: ... PCR reactions were performed in 25 μl volume with 2.5 μl of cDNA transcript using HotStar Taq DNA polymerase master mix (Qiagen) and previously described primer mixes ...
-
bioRxiv - Evolutionary Biology 2020Quote: PCR Kit (Buffer 2X, Qiagen, USA), and 1.4 µL of the primer mix ...
-
bioRxiv - Bioengineering 2024Quote: ... 2x volumes of P2 buffer (Qiagen) was added to the phage solution for lysis and 1.5x volumes of P3 buffer (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... using 1 µl of the cDNA product as template and either Fast Cycling PCR kit or HotStarTaq Plus Master Mix with a final concentration of 0.1 µM for each primer following the manufacturer’s protocols (Qiagen, Hilden, Germany). PREDICT universal controls 1 and 2 (Anthony et al. ...
-
bioRxiv - Genetics 2021Quote: Amplicons spanning the gRNA target sites were amplified from 1 µL of purified gDNA using HotStar PCR Master Mix (Qiagen). Half of each reaction was run on a 1.5% agarose gel ...
-
bioRxiv - Microbiology 2021Quote: ... 80 ng of total RNA was added as template for real-time PCR using QuantiFast SYBR green Master Mix (Qiagen) in the StepOne plus instrument (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... The himar1 enriched samples were diluted 1:50 and amplified by using a P5 indexing primer (AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC, [i5] barcode sequence) and P7 primer HotStarTaq Master Mix Kit (Qiagen) to add unique barcodes and the necessary P5 and P7 flow cell adaptor sites for Illumina sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplifications were carried out in 50-μL total volumes containing 1 μL of template using a DNA HotStarTaq Master Mix kit (Qiagen). The cycling protocol was as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μM gene specific primers pairs (hVDAC1, hVDAC2, hVDAC3, β-actin (Table 1) and 12.5 μl of master mix (QuantiFast SYBR Green PCR kit, Qiagen). Three independent experiments of quantitative real-time were performed in triplicate for each sample ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR reactions contained 4 μl of cDNA (1:50 dilution) and 200 nM of each primer (supplementary table 1) and QuantiTect SYBR Green PCR master mix (Qiagen) or SensiFAST SYBR Hi-ROX kit (Bioline) ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time quantitative PCR was performed on the Applied Biosystems 7500 system with QuantiTect SYBR Green PCR Master Mix (Qiagen) and the appropriate primers ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... several loci were amplified simultaneously from 1 μl of extracted DNA using 5 μl of the Multiplex PCR Master Mix (Qiagen) and varying amounts of the pooled primer mixes (Pool A ...
-
bioRxiv - Physiology 2020Quote: ... Pyrosequencing templates were prepared by PCR amplification (45 cycles) of approximately 30 ng bisulphite-treated DNA using HotStarTaq Master Mix (Qiagen), 150 nM biotinylated primer and 300 nM non-biotinylated primer (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2021Quote: We performed RT-qPCR, using the AceQ qPCR SYBR Green Master Mix (Q111-03, Vazyme) on the thermocyclers Rotor-Gene Q (Qiagen) or LightCycler 96 thermal cycler Instrument (Roche Applied Science ...
-
bioRxiv - Immunology 2019Quote: ... 10 μl of the gene expression assay (RT2 SYBR Green ROX qPCR Master Mix) (cat. # 330520, Qiagen, Valencia, CA, USA) and 1 μl of the relevant mouse RT2 qPCR Primer Assay ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 uM gene specific primers pairs (hVDAC1, hVDAC2, hVDAC3, ß-actin) and 12.5 ul of master mix (QuantiFast SYBR Green PCR kit, Qiagen). Three independent experiments of quantitative real-time were performed in triplicate for each sample ...
-
bioRxiv - Genomics 2022Quote: ... 32 μl Master Mix containing 30 μl MDA reaction buffer and 2 μl Phi29 polymerase (REPLI-g UltraFast Mini Kit; Qiagen) were added ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription was performed with SuperScript VILO Master mix by following the instructions of the manufacturer and subsequently cleaned with DNeasy blood and tissue kit (Qiagen) by only following step 3-8 ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription was executed using the SuperScript VILO Master mix by following the instructions of the manufacturer and subsequently cleaned with DNeasy blood and tissue kit (Qiagen) by only following step 3-8 of the manufacturers standard protocol ...