Labshake search
Citations for Qiagen :
501 - 550 of 2234 citations for Aminomethylphosphonic Acid 13C 99%;15N 98%;Methylene D2 98% 100 Ug Ml H2O since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA was eluted in 100 - 200 μL buffer AE (QIAgen).
-
bioRxiv - Genomics 2021Quote: ... Samples were suspended in 100 μl of commercially available (Qiagen) RLT buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by addition of 100 µl of proteinase K (QIAGEN) for 1 h at 45°C ...
-
bioRxiv - Genomics 2023Quote: ... followed by addition of 100 μl of proteinase K (QIAGEN) for 1 h at 45 °C ...
-
bioRxiv - Immunology 2023Quote: ... DNA was eluted in 100 µL of EB buffer (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... extracting DNA using the DNeasy PowerSoil Kit (Qiagen 12888-100), and preparing libraries for metagenomic sequencing using the Nextera DNA Flex Library Prep kit (Illumina 20018705) ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mL of fermentor culture was added to 4 mL RNAprotect Bacteria Reagent (Qiagen) and immediately vortexed for 10 sec ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 mL of culture were mixed with 6 mL of RNAprotect bacteria reagent (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mL of each culture was added to 2 mL RNAprotect Bacteria Reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... slides were treated with 1 mg/ml RNase A (1 mg/ml, Qiagen, 19101) in 2x SSC for at least 45 min at 37°C and then dehydrated in a 70% ...
-
bioRxiv - Microbiology 2024Quote: ... resuspended in 2 mL salts mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen), and then incubated for 5 min at room temperature for stabilization before centrifugation at 4000 rpm for 10 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 250 U/ml DNaseI (Qiagen), and 2.5 U/ml Papain (Worthington ...
-
bioRxiv - Cancer Biology 2020Quote: ... 0.2 mg/ml RNAse (Qiagen) and 20 μg/ml of propidium iodide (ThermoFisher) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 0.004mg/mL DNase I (Qiagen), and GBSS (Sigma) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.004mg/ mL DNase I (Qiagen), and GBSS (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: 6 ml Ni-NTA (QIAGEN) was washed with 5 column volumes of wash buffer 1 (150 mM NaCl ...
-
bioRxiv - Genomics 2022Quote: ... One mL of Qiazol (Qiagen) was added to an aliquot of 150 μl of plasma per sample ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of QIAzol (Qiagen) was added to each pellet suspension before being transferred to Lysing Matrix B tubes (MP Biomedicals) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 μg/ml DNase (Qiagen) and 100 μg/ml heparin (Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Microbiology 2019Quote: Total RNA was extracted from frozen samples using two acid phenol-chloroform-isoamyl alcohol extractions and immediately purified using the RNEasy MinElute kit (Qiagen). Ribosomal RNA (rRNA ...
-
bioRxiv - Genomics 2019Quote: ... Four hundred µL of 70% ethanol were added and nucleic acid extraction was immediately done with the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... We extracted total genomic DNA from blood and/or tissue samples using standard nucleic acid extraction kits (QIAamp DNA Mini Kit; Qiagen) automated on a QiaCube (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 nucleic acids were isolated from 300 µl viral transport media using the QIAamp Viral RNA Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were purified under denaturing conditions by nickel-nitrilotriacetic acid (NTA)-agarose affinity chromatography as described by the manufacturer (Qiagen). Polyclonal rabbit antisera were raised by Covance Research Products Inc ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted from stool samples using the RNeasy PowerMicrobiome kit automated on the QIAcube (Qiagen, Germantown, MD, USA), excluding the DNA degradation steps ...
-
bioRxiv - Microbiology 2021Quote: ... Total Nucleic Acid (TNA) was extracted from using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (Qiagen). Autopsy tissues were collected from lung ...
-
bioRxiv - Biophysics 2021Quote: ... MHC II with C-terminal hexahistidine tags on both α and β chains were expressed using a baculovirus expression system in S2 cells and purified using a Ni–nitrilotriacetic acid (NTA) agarose column (Qiagen). The histidine-tagged MHC bacmid (Malherbe et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant obtained after high speed centrifugation (20 000 x g for 30 min at 4 °C) was loaded on a gravity nickel-nitrilotriacetic acid (Ni-NTA) metal affinity column (Qiagen), washed with 10 column volumes (CV ...
-
bioRxiv - Microbiology 2020Quote: ... the samples were diluted further with RTL buffer to give a 1:60 w/v homogenate and total nucleic acid was extracted from 300 μl of the clarified sample using the RNA tissue mini kit without DNase (Qiagen) and eluted in a 60 μl volume.
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from yeast cells using either the acid phenol-chloroform method or an RNeasy Mini kit with on-column removal of DNA (Qiagen), both as previously described 28 ...
-
bioRxiv - Neuroscience 2022Quote: For the functional validation of the miR-124/Zfp36l1 interaction a custom made miRCURY locked nucleic acid (LNA) miRNA Power Target Site Blocker (TSB) (Qiagen) was used with the following sequence ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Biophysics 2022Quote: ... Supernatants were incubated with glutathione Sepharose (GSH) fast flow beads (GE-Healthcare) for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: Total viral RNA was extracted from deactivated samples using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (QIAGEN). One step reverse transcription to cDNA and real-time PCR (RT-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Developmental Biology 2019Quote: A locked nucleic acid (LNA) oligonucleotide probe antisense for the mature form of miR-92a-3p was designed and produced by Qiagen. The probe sequence was ACAGGCCGGGACAAGTGCAATA ...
-
bioRxiv - Genomics 2021Quote: ... Nucleic acids were purified from the lysates using the Qiagen AllPrep DNA/RNA mini kit (Qiagen Inc., Valencia, CA, USA), quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Purification of p53-(1-73) from the clarified cell lysate was accomplished using a Nickel Nitrilotriacetic Acid (Ni-NTA, Qiagen) column purification and 50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: His-FlhAC and His-FlgN were purified by Ni affinity chromatography with a nickel-nitriloacetic acid (Ni-NTA) agarose column (QIAGEN) as described previously12 ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR reactions were performed using the miRCURY LNA SYBR Green PCR Kit and the following locked nucleic acid (LNA) SYBR green primers from Qiagen: mmu-miR-598-3p ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated by extraction with hot acid phenol essentially as described in (67) and purified using an RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... using Qiagen DNA Blood and Tissue Mini kit on a QIAcube automated nucleic acid extraction system following manufacture’s protocol (Qiagen, MD). The nine whole-genome resequencing samples were extracted from ear pinna by mincing the tissue and incubating it overnight in 200 ug/ml Proteinase K at 55 °C with gentle shaking ...
-
bioRxiv - Physiology 2021Quote: ... We infected Sf9 cells with the recombinant virus to express and purify the His-tagged proteins using a nickel-nitrilotriacetic acid (Ni-NTA, Qiagen) column ...
-
bioRxiv - Neuroscience 2021Quote: ... The frozen brain tissue blocks of WRM and BF were boiled for 8 min and homogenized in 5% acetic acid using a TissueLyser LT (Qiagen) for 6 min at 50 Hz ...
-
bioRxiv - Cell Biology 2021Quote: Formalin-fixed paraffin-embedded tissues were used for in situ hybridization (ISH) employing locked nucleic acid (LNA) probes labelled with digoxigenin (DIG) at both the 5′- and 3’-ends (Qiagen). ISH was performed with probes specific for miR-132-3p (10 nM ...
-
bioRxiv - Immunology 2021Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Biophysics 2021Quote: ... Capture probes that contained locked nucleic acid (LNA) residues were purchased either from IDT with a 5′ Cy3 modification and HPLC purification or from Qiagen with a 5′ amino modification with HPLC purification ...
-
bioRxiv - Microbiology 2021Quote: ... as well as the relative amino acid content of SLPMh were calculated using the CLC Main Workbench 20.0.1 (QIAGEN, Aarhus, Denmark). Conserved domains in the amino acid sequence of SLPMh were identified based on hidden markov models via the HHPred server (Söding et al. ...