Labshake search
Citations for Qiagen :
451 - 500 of 2234 citations for Aminomethylphosphonic Acid 13C 99%;15N 98%;Methylene D2 98% 100 Ug Ml H2O since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged talin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a gel filtration column (Superdex 200 ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged vinculin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a Q-Sepharose ion exchange column ...
-
bioRxiv - Neuroscience 2023Quote: ... Deoayribonucleic acid (DNA) was extracted from stored buffy coat using the Blood Mini DNA kit (Qiagen, Valencia, CA). A TaqMan® single nucleotide polymorphism (SNP ...
-
bioRxiv - Microbiology 2023Quote: ... Viral nucleic acids were extracted using the QIAMP® Viral RNA mini kit (60 µL, Qiagen, Venlo, Netherlands) without the addition of carrier RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL DNase I and 200 µg/mL RNase A (Qiagen). Followed by a mild sonication (10 strokes ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mL of Ni-NTA agarose resin (Qiagen, 0.5 mL bed volume) was equilibrated in lysis buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.7 ml Qiazol (Qiagen) was added to each dish and the lysate was collected into Qiashredder tubes (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... 5 U/ml dispase (Stemcell) and 50 mg/ml DNase I mix (Qiagen) in complete RPMI1640 medium ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL DNase I (AppliChem) and 200 µg/mL RNase A (Qiagen) using 4 cycles of 15 s sonification at 30% duty cycle and 30% output control ...
-
bioRxiv - Biochemistry 2019Quote: ... and the supernatant was subjected into 9+ 9_ļ_ Ni2+ -nitrilotriacetic acid (Ni2+ -NTA) agarose resin (Qiagen, Valencia, CA, USA) for affinity chromatography purification ...
-
bioRxiv - Biochemistry 2019Quote: ... Acid-phenol based method was used to isolate total RNA and then purified using RNAeasy mini kit (Qiagen,USA) after a DNAse treatment (TURBO™ DNase ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by extraction of viral nucleic acids using a commercial kit (QIAamp MinElute virus spin kit, Qiagen, Venlo, Netherlands). A portion (2.5 µl ...
-
bioRxiv - Neuroscience 2020Quote: ESR1 expression was manipulated with custom-designed locked nucleic acid (LNA™) 15-mer antisense oligonucleotides designed by Qiagen following Kelly & Goodson.41 The antisense oligo for ESR1 knockdown (ESR1-KD ...
-
bioRxiv - Microbiology 2020Quote: ... Extraction of viral nucleic acids from clinical sample was performed with a QIAamp Viral RNA Mini Kit (Qiagen #52906) as described by manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... Nucleic acid was first extracted from each blood sample using QIAamp MinElute Virus Spin kits (Qiagen, Mississauga, Ontario, Canada) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Headless HA stalk proteins were expressed in 293F cells and purified using nickel-nitrilotriacetic acid agarose (no. 1018244, Qiagen) in 5-ml polypropylene columns (no ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acid sequence alignments and a phylogenetic tree of CEC3 homologs were generated using CLC Genomics Workbench8 (QIAGEN bioinformatics).
-
bioRxiv - Microbiology 2022Quote: ... followed by total nucleic acid extraction of 400 ul of pretreated stool using the EZ1 Virus Mini Kit v2.0 (Qiagen). Extracts were eluted in 60 ul volume.
-
bioRxiv - Microbiology 2022Quote: ... N-terminal His-tagged SlPR1 and SlChi3 proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant was collected and was mixed with a small volume of preequilibrated Ni-nitrilotriacetic acid (NTA) beads (Qiagen) for 2 h on a rocking platform at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 M urea [pH 8.0]) and His-tagged Tax proteins were precipitated with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen). After washing in buffer C (100 mM NaH2PO4 ...
-
bioRxiv - Neuroscience 2020Quote: ... PrP was expressed in Rosetta2(DE3)pLysS E.coli competent cells and purified by affinity chromatography using Ni2+-nitrilotriacetic acid Superflow resin (QIAGEN). In the RT-QuIC assay ...
-
bioRxiv - Neuroscience 2020Quote: ... was expressed in Rosetta2(DE3)pLysS E.coli competent cells and purified from inclusion bodies by affinity chromatography using Ni2+-nitrilotriacetic acid Superflow resin (QIAGEN). Recombinant hamster PrP (HaPrP ...
-
bioRxiv - Microbiology 2019Quote: Nucleic acids from the seven new isolates were extracted using a DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) or MasterPure Complete DNA and RNA Purification Kit (Epicentre ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acids from each sample were extracted using QIAamp 96 DNA kit and Qiacube HT robot (both from Qiagen). Viral RNA yields were measured using a RT-qPCR assay targeting the rdrp gene as previously described[13].
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were equalized and His6-HA-SUMO1-conjugates were enriched on nickel-nitrilotriacetic acid (NiNTA) agarose beads (Qiagen, #L30210) as described in15 ...
-
bioRxiv - Bioengineering 2022Quote: ... The cells were then lysed and the nucleic acid was extracted using Qiagen Allprep DNA/RNA Mini Kit (Qiagen). Aliquots of DNA were sent to Novogene Co ...
-
bioRxiv - Microbiology 2022Quote: ... protein enrichment and purification was performed as in(Bertani et al., 1999) using a Ni2+ nitriloacetic acid metal-affinity column according to the manufacturer’s instructions (QIAGEN). Proteins were resolved by tricine-SDS-PAGE (Schägger ...
-
bioRxiv - Immunology 2022Quote: ... The supernatant was harvested at day 4 after transfection and incubated with Ni-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen). The purification was carried out using gravity flow column and eluted with imidazole-containing buffer as previously described57,58 ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was extracted using hot acid-phenol (Uppuluri et al., 2007) and cleaned up using the RNeasy kit (Qiagen). Libraries were prepared using the NuGEN Universal Plus mRNA kit ...
-
bioRxiv - Microbiology 2023Quote: ... Extractions of viral nucleic acids from 140 µl samples were performed with the QIAamp Viral RNA Mini Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The kidneys were homogenized using 0.5 M acetic acid and two 5-mm steel beads in TissueLyser LT (Qiagen), followed by addition of pepsin to 0.1 mg/ml and incubation for 3 days ...
-
bioRxiv - Microbiology 2023Quote: ... The clarified supernatant was passed through the pre-equilibriated nickel-nitrilotriacetic acid (Ni-NTA) beads (Qiagen, Germantown, MD, USA) in a gravity flow column ...
-
bioRxiv - Microbiology 2023Quote: We extracted nucleic acids from each 200 μL aliquot using the AllPrep PowerViral DNA/RNA kit (Qiagen, Hilden, Germany) using Glass PowerBead tubes included with the kit ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was filtered through a 0.45 μm Millex-HV PVDF membrane and loaded on a nickel-nitrilotriacetic acid column (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: Sequences comparisons between 16S rRNA and bsh genes/BSH amino acid sequences were performed in CLC Genomics Workbench (Qiagen). 7α-HSDH sequence comparisons were performed using tblastn78 using the translated amino acid sequence from Clostridium absonum44.
-
bioRxiv - Microbiology 2023Quote: ... Three nucleic acid extraction kits designed for DNA and RNA extraction were compared: DNeasy PowerWater kit (QIAGEN; Hilden, Germany), NucleoSpin Soil ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Hybridization was performed at 66 °C overnight with 40 nM 5′ TYE-563-labelled locked nucleic acid (LNA)-(C4G2)2.5 probe (Exiqon Qiagen). Cells were then washed once in 2X SSC/0.1% Tween-20 for 5 minutes and three times in 0.1X SSC for 10 minutes at RT before being dehydrated as above and nuclei stained with DAPI.
-
bioRxiv - Molecular Biology 2019Quote: ... gambiae miR-276-5p miScript miRNA Mimic (100 ng, Qiagen) at a final concentration of 100 nm were co-transfected into Drosophila S2 cells using FuGENE HD transfection reagent (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: ... frozen embryos were lysed in 100 μl RLT buffer (Qiagen) containing 1 μl of 14.3M beta mercaptoethanol (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 100 nM FlexiTube siRNA to ARF6 (Qiagen, Valencia, CA) using 9.5 μl of Oligofectamine (Life Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 100 nM FlexiTube siRNA to ARF6 (Qiagen, Valencia, CA) using 9.5 μl of Oligofectamine (Life Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 100 nM FlexiTube siRNA to ARF6 (Qiagen, Valencia, CA) for 72 hours prior to plating and then seeded at 2×104 cells/well in complete media ...
-
bioRxiv - Genomics 2022Quote: ... 10 μL of protease mix (100 μg protease (Qiagen, 19155), 1x GC reaction buffer ...
-
bioRxiv - Microbiology 2020Quote: ... 100 μg of plasmid DNA (maxi prepped using Qiagen kit) was preloaded into O+ RBCs at 50% hematocrit in cytomix prior to culturing with parasite-infected RBCs ...
-
bioRxiv - Cancer Biology 2022Quote: ... 100 μM dNTPs and 2.0 U HotStar Taq polymerase (Qiagen) in a 25 μL volume ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 100 mM NaCl) with 700 U RNase A (Qiagen), 2500 U BaseMuncher Endonuclease (Abcam) ...