Labshake search
Citations for Qiagen :
51 - 100 of 3715 citations for 2 Methoxy 2 3 4 5 Tetrabde Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... cfDNA was extracted from 2 to 4 ml of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... The filtered supernatant was loaded onto 2 gravity columns each with 4 mL Ni-NTA agarose (Qiagen). The resin was pre-equilibrated with the lysis buffer ...
-
bioRxiv - Microbiology 2024Quote: Tissue samples of mice were transferred into 2 ml tubes containing 4 mm stainless steel beads (Qiagen) and 1 ml of ice-cold sterile saline ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Immunology 2020Quote: ... 5 U/ml dispase (Stemcell) and 50 mg/ml DNase I mix (Qiagen) in complete RPMI1640 medium ...
-
bioRxiv - Genomics 2023Quote: ... and 20 ug/mL RNase A (Qiagen, 19101) for 1 hour at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... and 20 ug/mL RNase A (Qiagen, 19101) for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Plant Biology 2023Quote: ... Collected tissue was ground to a fine powder at -80°C using 3 mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA), and between 10-15 mg of ground tissue per sample was used for auxin extraction ...
-
bioRxiv - Microbiology 2020Quote: ... and then with (2) 15 µl Proteinase K [>600 mA/ml] and 5 µl Rnase A [100 mg/ml] (Qiagen, Germany) for 5min at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... Total protein was normalized to 2 mg across all samples tested and incubated with 0.25 mL of 50% Ni-NTA resin (Qiagen) for 2 hours ...
-
bioRxiv - Genetics 2019Quote: ... cfDNA was extracted from 2 mL of plasma at baseline and from 3 mL of plasma post-treatment using QIAamp DNA purification kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: 2 mL of Ni-NTA resins (Qiagen, USA) were packed into a 5 mL column ...
-
bioRxiv - Immunology 2023Quote: ... 2 ml of Ni-NTA Agarose (Qiagen, 30310) was added per 50 ml of supernatant and the mix was left on a rolling platform at 4°C overnight ...
-
bioRxiv - Immunology 2024Quote: 2 ml MaXtract High Density tubes (Qiagen, 129056) were centrifugated at 12,000–16,000 × g for 20-30 second centrifugation ...
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were washed twice with PBS and then resuspended in Propidium Iodide (PI) staining solution (1x PBS supplemented with 50 µg/mL PI, Invitrogen; 100 µg/mL RNase A, Qiagen; and 2 mM MgCl2) and incubated for 30 min at room temperature in the dark) ...
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA concentration and purity were measured by a spectrophotometer and 2 ug were used to synthesize cDNA by QuantiTect Reverse Transcription kit (Qiagen). Real-time amplification was performed in a Mastercycler EP Realplex (Eppendorf ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Genomics 2022Quote: ... 2 μl of 100 mg/mL RNase A (Qiagen) was added and the tubes were incubated at 37°C for 15 minutes ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Lysates were clarified by centrifugation at 24,000gat 4 °C for 20 min and passed through 2 ml of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... Cell lysate was separated by centrifugation at 28000 x g for 45 min and 4°C and the supernatant was loaded onto a column containing 2 mL of Ni-NTA agarose (Qiagen) equilibrated with buffer A for 1 h for purification by nickel affinity chromatography ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysates were clarified by centrifugation at 24,000g at 4°C for 20 min and passed through 2 mL of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Genetics 2020Quote: ... in a 2 ml Eppendorf (Hamburg, Germany) tube using Stainless Steel Beads (5 mm) and the TissueLyzer (QIAGEN, Venlo, Netherlands). After an incubation time of 5 min ...
-
bioRxiv - Cancer Biology 2019Quote: Tumour tissue were collected into 2 ml tubes with pre-chilled steel beads (Qiagen Stainless Steel Beads, 5 mm, 69989) and stored at −80 °C freezer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... ∼2.5×108 cells (0.5 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Microbiology 2022Quote: ... of 0.2-0.3 was pelleted by centrifugation at 7000 x g for 5 minutes and pellets were resuspended in 1mL of ATGN media and incubated with 2 mL of RNAProtect reagent (QIAgen) for 15 min at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Plant Biology 2024Quote: ... The fresh leaf discs were transferred to a 2 mL tube containing a 5 mm stainless steel bead and 500 µL buffer RLT (QIAGEN). The leaf discs were disrupted using a TissueLyser LT (QIAGEN ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Genomics 2023Quote: Approximately 3-4 million cells were solubilized with 1 mL QIAzol (Qiagen, 79306) and 0.2 mL chloroform in 5PRIME Phase-Lock Gel heavy tubes (QuantaBio ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...
-
bioRxiv - Biochemistry 2020Quote: ... 4°C) an applied to a 2 ml Ni-NTA immobilised metal affinity chromatography (IMAC) gravity flow column (QIAGEN, Hilden, Germany). Columns were washed in 10 column volumes (CV ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and ∼55 mg of total protein in CFE was incubated for 60 min at 4 °C with 2 mL of Ni-NTA agarose (QIAGEN, Germany) equilibrated with purification buffer A ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from OSU-CLL cells (1.5e6 cells/mL) treated with DMSO or SpiD3 (1, 2 μM; 4 h) using the miRNeasy Mini Kit (Qiagen; Hilden, Germany) per manufacturer instructions and processed using the Universal Plus mRNA-Seq with NuQuant kit (Tecan ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mL of nickel-charged resin (Qiagen, Ni-NTA Agarose) was added to a column (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... in a 2 mL cryovial using a tissue lyser (Qiagen) and 0.2mm ceramic beads ...