Labshake search
Citations for Qiagen :
351 - 400 of 3715 citations for 2 Methoxy 2 3 4 5 Tetrabde Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... Groups of five flies were transferred to 2 mL tubes and were homogenized in 100μl PBS + 0.1% Triton X-100 using a TissueLyser LT (Qiagen). The samples were then spun down at 12,000 rpm and the supernatant transferred to fresh vials and the absorbance of each sample at 603 nm was measured using a NanoDrop ...
-
bioRxiv - Genomics 2021Quote: ... cfDNA was isolated from 2 ml of plasma using either the manual QIAamp circulating nucleic acid kit (Qiagen), or the semi-automated QIAsymphony DSP Circulating DNA Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli grown for 16 h in 250 ml of 2×YT medium using the Plasmid Maxi Kit (QIAGEN) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was placed into 2-mL round-bottom homogenizer tubes pre-loaded with Stainless Steel beads (#69989; Qiagen) and filled up with lysis buffer (#AA-LYS-16ml ...
-
bioRxiv - Systems Biology 2022Quote: ... Aliquots of 2 mL of cell cultures were submitted to DNA extraction using DNeasy Blood & Tissue kit (QIAGEN). DNA samples were quality checked and genotyped using PCR to confirm strains (Table S5) ...
-
bioRxiv - Genomics 2023Quote: ... The mixture was then transferred to a 2 mL MaXtract High Density tube (Cat#129056, Qiagen, Hilden, Germany) for phase separation ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼80 uL packed irradiated embryos and control embryos were resuspended in 2 mL buffer G2 (Qiagen, catalog # 1014636) and digested with proteinase K (1 mg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Systems Biology 2019Quote: ... Approximately ∼50 mg frozen tissue was pulverised in methanol-chloroform (300 µl, 2:1 v/v) using a TissueLyser (Qiagen, West Sussex, UK). Then the mixture was sonicated for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 4 µg RNAseA/ml (Qiagen 158922)] and placing cells on ice for 20 min ...
-
bioRxiv - Microbiology 2020Quote: ... by bead beating (50 Hz for 3 five-minute cycles, TissueLyzer II (Qiagen) with 0.1 mm silica beads) ...
-
bioRxiv - Evolutionary Biology 2023Quote: Tissue pools were homogenised for 2 min at 30 Hz using 5 mm steel beads on a TissueLyser II instrument (Qiagen, Germany). A volume of 0.2× chloroform (Carl Roth ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Microbiology 2021Quote: ... Maize and soybean leaf and root tissue were pulverized for 2-min at a speed of 30 Hz with two 4-mm stainless balls in a TissueLyser II (Qiagen, Venlo, Netherlands). Total DNA was extracted from plant tissues with the OMEGA Mag-Bind Plant DNA Plus kit (Omega Bio-Tek ...
-
bioRxiv - Microbiology 2024Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 100,000 g (31,000 RPM) for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen, Germantown, MD) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 ml of Matrigel basement membrane matrix (Qiagen #354234) prepared in serum free culture medium (1:8 ratio to reach final concentration of 1.2 mg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... CjNC110-LNA DIG-labeled probe (/5’DigN/ GCACATCAGTTTCAT/3’Dig_N/) (QIAGEN) was added to 15 mL DIG EasyHyb™ Buffer (Roche ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 μl of proteinase K (approximately 3 U, Qiagen, cat. # 19131) were added and incubated for 1 h at 56°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen, #1027281). After 72 h ...
-
bioRxiv - Cell Biology 2023Quote: ... using 30 nM Hs_LUZP1 siRNA (target sequence, 5′-CAGCGGGTGCTGAGAATTGAA-3′; QIAGEN) or 30 nM AllStars negative-control siRNA (QIAGEN) ...
-
bioRxiv - Molecular Biology 2019Quote: ... worms were homogenized in PBS (50 μl/adult worm pair or 50 μl/1000 schistosomula) at 4°C using a TissueLyser II (Qiagen), homogenates were incubated overnight with mixing at 4°C and the supernatants collected by centrifugation at 15,000 g for 1 h at 4°C ...
-
bioRxiv - Pathology 2024Quote: ... by running one homogenization cycle (50 Hz oscillation frequency (50 cycles/s) for 4 minutes) in a Tissue lyser LT (Qiagen). Tubes were then centrifuged at 5000 rpm for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 ng of pFLAG expression vectors or empty plasmids and 50 ng psiCheck-2 plasmid were transfected using Effectene transfection reagent (Qiagen, Netherlands, Cat. No. 301425), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Both the input and IP samples were incubated at 50°C for 2 hr and then cleaned up using the Qiaquick PCR Purification Kit (Qiagen, Hilden, Germany, Cat # 28104) and eluted in 35 μL of water.
-
bioRxiv - Biophysics 2021Quote: cfDNA was isolated from 2 mL of plasma for each sample via the QIAamp Circulating Nucleic Acid kit (Qiagen). ddPCR was performed using the QX200 Droplet Digital PCR System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... each individual cell was transferred to a 0.2 ml PCR tube containing 2 μl of lysis buffer (RLT Plus - Qiagen). The tube was immediately placed on a metal plate sitting on top of dry ice for flash-freezing ...
-
bioRxiv - Biochemistry 2021Quote: ... One half of clarified cell lysate (2 ml) was applied to 200 μl of Ni-NTA Superflow resin (Qiagen) equilibrated with Ni wash buffer (20 mM HEPES pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: ... The aqueous phase was removed and transferred to MaxTract High Density 2 mL tubes (Qiagen Inc, Valencia, CA, USA). Samples were then extracted a second time as described above and the aqueous phase from the repeated extractions for each sample were combined ...
-
bioRxiv - Microbiology 2022Quote: ... 1 to 2 mL of culture were mixed with the same volume RNAprotect™ Bacteria Reagent (Qiagen, Hilden, Germany) incubated for 10 min and centrifuged ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mL of logarithmic growth phase culture was pelleted by centrifugation and resuspended by vortexing in B1 buffer (Qiagen, Hilden Germany ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant containing target proteins was passed through a polypropylene column containing 2 ml Ni-NTA resin from Qiagen. After the target protein bound to the Ni-NTA resin ...
-
bioRxiv - Biochemistry 2023Quote: ... Lysates were clarified by centrifugation at 24,000 g for 30 min and applied to a 2 mL column bed of Ni-NTA resin (Qiagen) for purification by IMAC ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was extracted from 2 mL of each of the nine overnight cultures (DNeasy Blood & Tissue Kit; Qiagen). Library preparation and sequencing was performed by Novogene Europe (Cambridge ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAse A (5 μg/mL, Qiagen #19101) was added to the whole cell extracts (WCE ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.7 × 10−5 AU/mL protease (Qiagen), 1.0 μM barcoded oligodT-ISPCR primer ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated from cultures infected with rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 using the QIAamp Viral RNA mini kit (Qiagen) and cDNA synthesis was performed using SuperScript III using hexamers (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from control (n = 2) and olaparib-treated (n = 2) GTFB-PDX1009 ascites using the RNeasy Plus Mini kit (Qiagen). RNA quality was confirmed using an Agilent TapeStation and all RNA used for library preparation had a RIN>9 ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...