Labshake search
Citations for Qiagen :
451 - 500 of 3715 citations for 2 Methoxy 2 3 4 5 Tetrabde Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen), pools of siRNAs targeting the TP53 sequence 5’-GAAAUUUGCGUGUGGAGUA-3’ ...
-
bioRxiv - Genomics 2021Quote: ... The scramble-miR miRCURY LNA Detection probe (5’-GTGTAACACGTCTATACGCCCA-3’, YD00699004, QIAGEN) was used as a negative control ...
-
bioRxiv - Genetics 2020Quote: ... The 3’ and 5’ – DIG labeled miRCURY LNA miRNA Detection probes (Qiagen, negative control Scramble-miR cat ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4-5 hours later DNA was transfected using Attractene (Qiagen). Briefly ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 mL of culture were mixed with 6 mL of RNAprotect bacteria reagent (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL DNase I and 200 µg/mL RNase A (Qiagen). Followed by a mild sonication (10 strokes ...
-
bioRxiv - Biochemistry 2021Quote: ... Medium was stirred for 1 hour at 4°C in the presence of 5 ml Ni-NTA Agarose beads (Qiagen, Venlo, The Netherlands) washed with 25 mM Hepes-KOH pH 7.5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL Proteinase K (20 mg/mL, Qiagen) and 100 µl 10% SDS (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... in 5-ml polypropylene columns (no. 34964; Qiagen), washed with 50 mM Na2HCO3 ...
-
bioRxiv - Microbiology 2021Quote: ... in a 5 ml tube (Qiagen, DNAse/RNAsefree). The sediment samples were kept at 4 °C until the next day and then stored at −80 °C ...
-
bioRxiv - Immunology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and ground for 2 min using a TissueLyser (Qiagen). DNA extraction was performed using a 96-well column based kit ...
-
bioRxiv - Genomics 2019Quote: ... and BS (2) EpiTect Bisulfite Kit (QIAGEN, Hilden, Germany) respectively according to the manufacturers’ recommendations ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM PMSF) on a Ni-NTA resin (Qiagen). Bound proteins were washed (50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) containing 0.1% Tween20 (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... the 2 proteases of proteinase K (Qiagen, Hilden, Germany) and dispaseII (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) are added to one volume of bacterial culture ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µl Qiagen CL buffer (10x; Qiagen, Hilden, Germany), 0.4 µl MgCl2 (25 mM ...
-
bioRxiv - Plant Biology 2020Quote: ... a 2 ml subsample of the coarse powder was ground to a fine powder using a Qiagen TissueLyser (Qiagen, Germantown, MD). Finely powdered leaf tissue was then sent to Midwest Laboratories (Omaha ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant containing solubilized protein was filtered using a 0.22 μM nylon membrane filter and incubated with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germantown, MD) at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... mantle (Ma) and gonad (Go) tissues were collected and individually transferred to 2-mL tubes containing RNA later (QIAGEN, Maryland, USA) separately ...
-
bioRxiv - Genomics 2021Quote: ... The samples were then transferred to RNeasy spin columns and 2 ml collection tubes from an RNeasy Mini Kit (Qiagen, 74104) and centrifuged at 13,000 rpm for 15 sec ...
-
bioRxiv - Genomics 2022Quote: Buccal swab samples were placed in 2 mL Eppendorf tubes and were extracted using a modified version of the DNeasy® Blood and Tissue Kit (Qiagen). In each tube were added 380 μL of ATL Buffer and 20 μL of Proteinase K (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... or remaining mosquito bodies were collected separately in a 2ml Eppendorf Safe Lock tube with 250μl DMEM (2% FBS, 1% Sodium Pyruvate) with 25 mg/ml Amphotericin B and a stainless steel bead (Qiagen, Hilden, Germany). Samples were stored at −80°C.
-
bioRxiv - Immunology 2022Quote: ... 350 µL of aqueous phase was transferred into a 2 mL reaction tube and subjected to the QIAcube (QIAGEN, Hilden, Germany) for RNA isolation ...
-
bioRxiv - Neuroscience 2023Quote: ... After protein digestion (PK Buffer and Proteinase K (20 mg/mL) for 2 hrs at 45°C) DNA was purified with QIAquick PCR Purification Kit (Qiagen, Germany) according to manufacturer instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7.5 ml blood were drawn into EDTA-blood collection tubes and processed within 2 h using the AdnaTest (Qiagen, Hilden, Germany). Patients were divided into HSPC ...
-
bioRxiv - Cancer Biology 2023Quote: ... Deproteination of the D-2-HG quantification aliquot was achieved using 3.0 mL of Proteinase K (Qiagen, Catalog #19131, Hildren, Germany) per 100.0 mL of cell lysis solution ...
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 3 mL of Ni-NTA resin (Qiagen) for 1.0 h at 4 °C and then applied to a gravity flow column ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...
-
bioRxiv - Microbiology 2019Quote: ... Proteinase K solution (50 μL at 20 mg/mL, QIAGEN/5PRIME) and SDS solution (100 μL at 20% ...
-
bioRxiv - Immunology 2021Quote: ... and 50 mg/mL DNase I mix (Qiagen, Germantown, MD, USA) in complete RPMI1640 medium] at 37 °C for 4 hrs ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 mL of 50% Ni-NTA agarose (Qiagen, Toronto, Ontario, Canada) was equilibrated using 10 bed volumes of wash buffer (same formulation as lysis buffer) ...
-
bioRxiv - Biophysics 2024Quote: ... Pre-equilibrated nickel-NTA resin (Qiagen, 50 mg/mL binding capacity) was added to the clarified lysate and the lysate-resin slurry stirred in a beaker with a stir bar for 1 hour at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL DNase I (AppliChem) and 200 µg/mL RNase A (Qiagen) using 4 cycles of 15 s sonification at 30% duty cycle and 30% output control ...
-
bioRxiv - Systems Biology 2020Quote: ... was prepared by centrifuging a cell culture at 5525xg for 2 minutes at 4°C then resuspending cells in 1mL of PBS-RNAprotect (333 μL RNAprotect Bacteria Reagent [76506, Qiagen, Hilden, Germany], 666 μL PBS). For immediate RNA stabilization by RNAprotect (Fig ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time PCR assays were carried out in triplicate to amplify the Wolbachia wsp gene [43] and host reference gene GAPDH (378 F_ 5’-CCGGTGGAGGCAGGAATGATGT-3’, 445 R_5’-CCACCCAAAAGACCGTTGACG-3’) on a Rotor-gene Q Instrument (Qiagen, NSW, Australia). Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was extracted by incubation with 6 ml of lysis buffer (50 mM Tris pH 8.0, 50 mM EDTA, 1% SDS, 0.1 mg/ml proteinase K (Qiagen, 19131)) at 55°C for 16 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Genetics 2019Quote: ... and supernatant was mixed with 10 times its volume of “2M70” binding buffer (2 M guanidine hydrochloride and 70% isopropanol) in a 15 mL tube and passed through QIAquick silica columns (Qiagen, Hilden, Germany) using 25 mL tube extenders (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... One million cells per well were seeded in 6 well plates in 2 mL growth medium the day before transfection and transfected with PolyFect (Qiagen, Düsseldorf, DE) using the manufacturers protocol (changing the medium to growth medium without hygromycin B and puromycin prior to transfection) ...
-
bioRxiv - Immunology 2021Quote: ... The dried DNA pellet was reconstituted in 50 μL H2O treated with 330 μg/mL of RNase A for 2 hours at 37°C and then recovered using the QIAquick PCR Purification kit (QIAGEN Cat#28104). DNA concentration was determined by Qubit (Thermofisher).
-
bioRxiv - Microbiology 2020Quote: ... bearing a C-terminal histidine tag (ACRO Biosystems, Newark, NJ) was coated at 2 μg/ml on a Ni-NTA plate (Qiagen, Valencia, CA). After washing and blocking ...
-
bioRxiv - Immunology 2020Quote: ... 1µg/ml Aprotinin, 1mM PMSF) using 5mm Stainless Beads and TissueLyser II (frequency: 30/sec, duration 2 × 30 sec) (Qiagen, Hilden, Germany). IL-23 was measured using either a mouse IL-23 ELISA (R&D ...
-
bioRxiv - Microbiology 2022Quote: ... The volume of mid-exponential phase culture to achieve 5 × 108 CFUs was calculated (assuming OD600 of 1.0 yields 109 CFUs/mL) and added to 2 volumes of RNAprotect Bacteria Reagent (QIAGEN, cat. no. 74124). The mixture was immediately vortexed for 5 sec ...
-
bioRxiv - Physiology 2022Quote: ... was broken up in 750 μl (TriFast USA) in a 2 ml Eppendorf (Hamburg, Germany) tube using the TissueLyzer (QIAGEN, Venlo, Netherlands) with stainless steel beads (5 mm) ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA for the Pacific Bioscience Single Molecule Real-Time (SMRT) sequencing was prepared from 2 mL of fresh blood using the genomic-tip 100/G kit (Qiagen, Hilden, Germany). This was performed with additional RNase (Astral Scientific ...