Labshake search
Citations for Qiagen :
651 - 700 of 3715 citations for 2 Methoxy 2 3 4 5 Tetrabde Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were loaded onto a 5 mL Ni-NTA Superflow Cartridges (Qiagen) equilibrated with Buffer B (25 mM HEPES ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen) and the column was washed with lysis buffer supplemented with 25 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleared lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen). The column was washed in two steps with lysis buffer supplemented with 25 mM and 100 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleared lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen) and the column was washed in two steps with lysis buffer supplemented with 25 and 50 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was incubated with 5 ml of Ni-NTA resin (Qiagen) for 2h ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cleavage reaction was run over a 5 mL Streptactin column (Qiagen) to remove any uncleaved HELB and free StrepII peptide and the cleaved HELB-containing flow-through collected ...
-
bioRxiv - Biochemistry 2021Quote: ... Cleared lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen) and the column was washed in two steps with lysis buffer supplemented with 25 and 50 mM imidazole ...
-
bioRxiv - Biochemistry 2021Quote: ... The lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen) and the column was washed with lysis buffer supplemented with 25 mM imidazole ...
-
bioRxiv - Biochemistry 2021Quote: ... Cleared lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen). The column was washed in two steps with lysis buffer supplemented with 25 and 100 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cleared lysate was loaded on a 5 mL Ni-NTA column (Qiagen) equilibrated with buffer C ...
-
bioRxiv - Microbiology 2022Quote: ... then 5 µl of RNAse A (10 mg/ml; Qiagen, Hilden, Germany) was added and the sample was incubated for 30 min at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Harvested cells were fixed overnight in 5 mL RNA Protect reagent (Qiagen) after incubation with compounds ...
-
bioRxiv - Biochemistry 2022Quote: ... and purified by affinity chromatography using a 5 mL Ni-NTA (Qiagen) column ...
-
bioRxiv - Genetics 2023Quote: ... The supernatant was incubated with 5 ml of Ni- NTA resin (Qiagen) for 2h ...
-
bioRxiv - Physiology 2021Quote: ... 10-50 mg tissue was homogenized (1 mM EDTA and 4 mM sodiummetabisulfite, pH 7.4) using a TissueLyser II (Qiagen). Samples where adjusted to the same weight/volume percentage by adding a volume of homogenization buffer and the NA content was measured by ELISA (BA E-5200 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lysates were treated with 4 μl of 100 mg/ml RNase A (QIAGEN) at 37 °C shaking at 500 RPM for 3 hours ...
-
bioRxiv - Microbiology 2024Quote: ... An 80 μL sample of the supernatant was transferred to a new tube and incubated with 5 μL of 5 mg/mL Proteinase K (QIAGEN) for 1 h at 60°C ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were transfected with 50 nM double-stranded siRNA oligonucleotides (Supplementary Table 3) using HiPerFect Transfection Reagent (Qiagen, Crawley, UK).
-
bioRxiv - Immunology 2019Quote: Total RNA yields from the PBMC and stimulated PBMCs were in the range of 3 micrograms (50-100 ng/μl in 30μl Qiagen EB buffer) determined by absorbance at 260nm on the NanoDropTM One (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Molecular Biology 2022Quote: ... The supernatant was loaded onto a 10 mL Ni-NTA Superflow cartridge (connected two 5 mL cartridges) (30761, Qiagen). The cartridge was washed with 100 mL R buffer containing 200 mM NaCl ...
-
bioRxiv - Physiology 2023Quote: ... RNA was pooled from 3-4 wells of an MEA plate and then extracted using the miRNeasy kit (Qiagen). RNA levels were measured using the nanoString nCounter® PlexSet™ (nanoString ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatant was then incubated with 3 ml of Ni-NTA Superflow agarose beads (QIAGEN), which were preequilibrated with bacterial lysis buffer ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA from approximately 25-50 EBs at day 5 of differentiation was isolated using RNeasy Mini kit (Qiagen) and quantified by NanoDrop (Thermo Fisher) ...
-
bioRxiv - Genomics 2020Quote: ... S2 cells were transfected with 1 ug plasmid DNA using the Effectene reagent kit (Qiagen). The plasmid DNA which contains cDNA of FLAG-tagged ECDs are under the metallothionein promoter control ...
-
bioRxiv - Biochemistry 2019Quote: ... The lysate was centrifuged for 10 min at 16,200xg 4°C and 600 μL of the supernatant was added to a 50 μL slurry of Ni-NTA Agarose (Qiagen) that had been washed three times with 250 μL A3B-CTD lysis buffer without 2-mercaptoethanol and once with 250 μL of A3B-CTD lysis buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting samples were supplemented with 300 mM NaCl and 10 mM imidazole and incubated overnight at 4 °C on a stirring wheel with 50 µl Ni-NTA agarose resin slurry (QIAGEN) pre-equilibrated with wash buffer I (50 mM Tris-HCl pH 7.8 ...
-
bioRxiv - Cell Biology 2020Quote: ... and run on the RT^2 First Strand Kit (Stem cell PCR array) (Qiagen). The array was run in triplicate (N=3 ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA (2 μg) was extracted from MPB with the RNeasy Mini Kit (Qiagen) and then reverse-transcribed using the First Strand cDNA Synthesis Kit (Life Technologies) ...
-
bioRxiv - Immunology 2019Quote: RNA was extracted from 2×106 human PMNs using the RNeasy Mini Kit (Qiagen) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 µg of total RNA were isolated using the Qiagen RNeasy Mini Kit (Qiagen) and further processed in Illumina’s TruSeq Stranded mRNA Library kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... recombinant protein was enriched via a Ni+2-nitroloacetic acid column (Ni-NTA; Qiagen), as described previously (Edwalds-Gilbert et al ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from 1-2 million cells using RNeasy Mini Kit (QIAGEN) using QIAcube (QIAGEN) ...
-
bioRxiv - Neuroscience 2020Quote: ... and agitated at 30 HZ for twice 2 minutes in the TissueLyser II (Qiagen). RNA isolation was performed on the QIAsymphony (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were lysed with 27G1/2 needles and then homogenized with QiAshredder columns (Qiagen). Total RNA from triplicate experiments were purified with the RNAeasy Plus Kit (Qiagen) ...
-
bioRxiv - Systems Biology 2020Quote: ... mechanically homogenized and further lysed in RLT buffer with 2-mercaptoethanol on TissueLyser (Qiagen) with 3 mm beads then extracted according to the protocol using RNeasy Mini Kit (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... The cleared lysate was run through Ni+2-NTA agarose beads (Qiagen [QA], 30250) to allow binding of the histidine-tagged (recombinant ...
-
bioRxiv - Molecular Biology 2022Quote: ... and homogenized for 2 cycles with a Bead Beater TissueLyser II (Qiagen, Germantown, MD) at 24 Hz for 3 min each ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM 2-mercaptoethanol) and the proteins eluted from nickel-NTA agarose beads (Qiagen; using buffer containing 25 mM Tris-HCl (pH 7.6) ...
-
bioRxiv - Microbiology 2022Quote: RNA was isolated from 2 x 106 cells using RNeasy plus mini Kit (Qiagen). Reverse transcription was performed with either random decamers or HIV antisense-specific primers ...
-
bioRxiv - Microbiology 2020Quote: ... Lung samples were homogenized with DMEM + 2% FBS in a TissueLyser (Qiagen Inc., CA) operated at 25-30 Hz for four minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cell lysate supernatant was passed through a Ni+2-NTA resin column (Qiagen), and protein was purified following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... 20 mg ground freeze-dried tissue (TissueLyserII Qiagen, Hilden, Germany; 2×45sec, 30 Hz) was used for DNA extraction (DNeasy Plant Mini Kit ...
-
bioRxiv - Paleontology 2019Quote: ... plasmid minipreps were purified with a QIAprep Miniprep Kit (Qiagen, chimpanzee 1 and 2), and RBC Miniprep Kit (YPD100 ...