Labshake search
Citations for Qiagen :
351 - 400 of 10000+ citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNA was isolated from 5 million cells using the DNAeasy kit (Qiagen). 4ug gDNA was digested with NlaIII or MseI ...
-
bioRxiv - Immunology 2019Quote: ... total RNA (5 mice per group) was extracted using RNeasy Micro Kit (QIAGEN). Samples were sent to Admera Health for sequencing and analysis ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted from 5 ml samples using the miRNAeasy mini kit (Qiagen), treated with TURBO DNase (Ambion ...
-
bioRxiv - Molecular Biology 2023Quote: mRNA was extracted from ∼5×106 cells using the miRNeasy Mini Kit (QIAGEN). Library preparation and sequencing was conducted by City of Hope Integrative Genomics Core ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA from 5×107 cells was extracted using RNeasy mini kit (Qiagen). One μg total RNA was used for cDNA synthesis using Quantinova Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... 37°C in 5% CO2 and purified with a RNeasy mini kit (Qiagen) according to the protocol for Gram-positive bacteria ...
-
bioRxiv - Genomics 2019Quote: ... Plates grown in parallel were used for genomic DNA extraction (DNeasy Blood & Tissue kit, Qiagen), and RNA extraction (TRIzol ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from all samples (5 CTRL and 5 SCZ subjects at six timepoints across astrocyte differentiation) using either the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) or the MagMax mirVana Total RNA Isolation Kit (Thermo Fisher) ...
-
bioRxiv - Microbiology 2024Quote: ... IFAS and LifeGuard Soil Preservation were transferred into a 5 mL bead beating tube from DNeasy PowerWater kits for 5-minutes of vortexing (Qiagen, Hilden, Germany). Afterwards ...
-
bioRxiv - Microbiology 2019Quote: The Microbial DNA qPCR Array Intestinal Infection 2 kit (Qiagen, Hilden, Germany) (Supplementary table 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2-mercaptoethanol and purified using the RNeasy Micro kit (Qiagen).
-
bioRxiv - Plant Biology 2021Quote: ... nks1-1 and nks1-2 using RNeasy Plant mini kit (74904, QIAGEN). cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691 ...
-
bioRxiv - Microbiology 2022Quote: ... (2) PCR purification was conducted using the QIAquick PCR Purification Kit (Qiagen), and (3 ...
-
Coding and non-coding drivers of mantle cell lymphoma identified through exome and genome sequencingbioRxiv - Genomics 2019Quote: ... from pellets of 2 × 106 cells using the RNeasy mini kit (Qiagen) or RIPA buffer ...
-
bioRxiv - Genetics 2020Quote: ... rad54-1 and rad54-2 plants using RNeasy Plant mini Kit (QIAGEN), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and a 2% agarose gel using the QIAquick gel extraction kit (Qiagen). In a second PCR ...
-
bioRxiv - Genomics 2021Quote: SARS-CoV-2 RNA was extracted with QIAamp Viral Mini Kit (Qiagen) in a QIACube extractor or with Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... for DNA extraction and (2) RNeasy Mini Kit (Qiagen, cat. no. 74104) for RNA.
-
bioRxiv - Microbiology 2024Quote: ... or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0, Qiagen). Then ...
-
bioRxiv - Immunology 2024Quote: ... 2 × QuantiFast SYBR Green PCR Master Mix kit (QiaGen, Cat No. 204056) was used following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated from cultures infected with rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 using the QIAamp Viral RNA mini kit (Qiagen) and cDNA synthesis was performed using SuperScript III using hexamers (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from control (n = 2) and olaparib-treated (n = 2) GTFB-PDX1009 ascites using the RNeasy Plus Mini kit (Qiagen). RNA quality was confirmed using an Agilent TapeStation and all RNA used for library preparation had a RIN>9 ...
-
bioRxiv - Plant Biology 2019Quote: ... coli BL21 from pET16b-based plasmids and affinity purification via Ni-NTA (Qiagen), followed by specificity tests (Supplemental Figure 14).
-
bioRxiv - Genomics 2019Quote: ... DNA was extracted with a salt-based method and an RNAse A (Qiagen) treatment was applied following the manufacturer’s recommendation ...
-
bioRxiv - Neuroscience 2021Quote: ... gene type was determined based on the classification from Ingenuity Pathway Analysis (Qiagen). For peptide hormones ...
-
bioRxiv - Cancer Biology 2022Quote: Based on the amount of cells homogenized in the RLT buffer (79216, Qiagen), the total RNA was isolated using the RNeasy Mini Kit (74106 ...
-
bioRxiv - Neuroscience 2023Quote: ... Lysed samples were then loaded onto a column-based shredder (QIAshredder, Qiagen, Germany) and centrifuged (8000 g for 2 min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2021Quote: ... Resultant cDNAs were used as template for qPCR and qPCR was performed on an Applied Biosystems 7900HT Sequence Detection system using a Sybr Green Quantitect kit (QIAGEN, Hildesheim, Germany). Quantification cycle (Cq ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Genetics 2019Quote: Total RNA from whole 3 day old larvae was extracted using the RNeasy mini kit (Qiagen) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA samples obtained from 3 biological replicates were purified using RNeasy Mini Kit (#74104, Qiagen) according the manufacturer instructions with a DNase digestion step (#79254 ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was isolated from control and GDC-RPC-3 cells using the RNeasy PlusMini Kit (Qiagen). High-quality (Agilent Bioanalyzer RIN>7.0 ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA (n=3/experimental group) was extracted from macrophages with RNeasy Mini Kit (Qiagen, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: RNA was extracted from 3 million transfected cells using the All Prep DNA/RNA kit (Qiagen) and quantified by Nanodrop 1000 ...
-
bioRxiv - Microbiology 2020Quote: The 3 Kb mutagenic DNA fragments were purified using a QIAquick PCR Purification Kit (Qiagen; 28106) and transformed into V ...
-
bioRxiv - Genetics 2021Quote: RNA was extracted from an aliquot of 3 × 106 cells using the RNeasy Plus Kit (Qiagen). cDNA was synthesized from extracted RNA using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... Media and osteoblasts were harvested 3 days later and EVs were collected using Exoeasy kit (Qiagen). Total RNA was extracted using miRNeasy micro (Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: ... RNA from 3 x 106 HMC-1.2 cells was extracted using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-month-old zebrafish (1 fish/sample) using the RNeasy Mini Kit (Cat. No. 74104; Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Genetics 2022Quote: ... 3 min in 37°C shaker) and processed with DNeasy Blood and Tissue Kit (QIAGEN #69504). Two hundred ng of genomic DNA was used as input in the DamID protocol that included an improved pool of AdR primers as described (de la Cruz Ruiz et al ...
-
bioRxiv - Biochemistry 2023Quote: The total RNA was extracted from 3 × 106 HEK293T cells using the RNeasy Mini Kit (QIAGEN). RNA served as a template for subsequent reverse transcription into cDNA by iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and total RNA was extracted using the RNAeasy Mini kit (Qiagen, 74104; n = 3 independent experiments). Prior to library construction ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were seeded in 6-well and 12-well plates at a density of 1.25×105-5×105 cells per well and transfected with miR-320a mimic (Qiagen, 339173 YM00471432) or antagomir (GenePharma ...
-
bioRxiv - Immunology 2021Quote: ... Single cells were sorted into individual wells of a 96-well plate containing 5 μl of lysis buffer (TCL buffer (Qiagen #1031576) with 1% of 2-b-mercaptoethanol) ...
-
bioRxiv - Immunology 2020Quote: ... Single CD3-CD8-CD14- CD16- CD20+CD38+ BG505 SOSIP+YU2-gp140+ B cells were sorted into individual wells of a 96-well plates containing 5 μl of a lysis buffer (Qiagen, 1031576) per well using a FACS Aria III (Becton Dickinson) ...