Labshake search
Citations for Qiagen :
201 - 250 of 10000+ citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: c-miR isolations from blood serum were carried out using affinity column-based miRNeasy Serum/Plasma Advanced Kit (217204, Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted using a modified phenol:chloroform:isoamyl based DNA extraction protocol of the DNeasy PowerWater SterivexTM Kit (MoBio-Qiagen, vHilden, Germany) as described in Appleyard et al ...
-
bioRxiv - Microbiology 2019Quote: ... All samples were run in duplicate and concentration calculated based on standard curves generated using bacterial genomic DNA (extracted with DNeasy PowerSoil Pro kit, Qiagen) or fungal genomic DNA (extracted with YeaStar Genomic DNA Kit ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted using a modified phenol:chloroform:isoamyl based DNA extraction protocol of the DNeasy PowerWater SterivexTM Kit (MoBio-Qiagen, vHilden, Germany) as described in Appleyard et al ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted using a modified phenol:chloroform:isoamyl based DNA extraction protocol of the DNeasy PowerWater SterivexTM Kit (MoBio-Qiagen, vHilden, Germany) (Appleyard ...
-
bioRxiv - Molecular Biology 2023Quote: ... cf-DNA quantified from various plasma or serum types using either MitoQuicLy or a silica-based membrane column DNA extraction kits (DNeasy, Qiagen). A total of 50 samples were analyzed (5 biofluids ...
-
bioRxiv - Genetics 2023Quote: ... RNA was harvested from animals using a TRIzol-based extraction method and RNA was purified using a RNeasy Mini Kit (Qiagen). cDNA was synthesized using the QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2) DNeasy Blood and Tissue Kit (Qiagen, Germany); 3 ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of Taq PCR Master Mix kit (Qiagen), 0.4 μl of each primer (100 pmol/μl ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 μL water and 5 μL 2x QuantiFast® SYBR® Green PCR Master Mix (Qiagen). Technical duplicates of this reaction mix were then analyzed on a Corbett Rotor-Gene 6000 real-time PCR cycler ...
-
bioRxiv - Cell Biology 2022Quote: ... A Locked Nucleic Acid (LNA) probe was used to detect centromere regions (5’-TTGGCTACACCATGAAAGCTT-3’; Qiagen). 20 μL of probe mix (250 nM LNA probe ...
-
bioRxiv - Biophysics 2019Quote: ... and subjected to Ni-NTA based affinity chromatography (QIAGEN). Eluted protein was further purified by anion exchange chromatography (MonoQ 5/50 GE Healthcare Life Sciences ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted using either a column-based (Qiagen QIAmp DSP Viral RNA Mini Kit ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted using either a column-based (Qiagen QIAmp DSP Viral RNA Mini Kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 U HotStar Taq (Qiagen; based on polymerization activity), and 32 U FEN1 (New England Biolabs) ...
-
bioRxiv - Pathology 2022Quote: ... with stainless steel beads (2×5 mm) using a TissueLyser (Qiagen, Germantown, MD) for three minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... with 2 × 5 mm stainless steel beads using the TissueLyser (Qiagen, Hilden, Germany) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 2–5 min with steel balls in a tissue lyser (Qiagen, Germany). Tissue lysates were incubated with the buffer at 4°C overnight (cell samples were incubated in lysis buffer for 30 min at 4°C) ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Immunology 2023Quote: Total mRNA was isolated from 5×105 cells using a kit (RNeasy kit, QIAGEN) and reverse-transcribed using oligo(dT)20 primer (SuperscriptIII ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cancer Biology 2023Quote: 2 × 105 cells were reverse-transfected in 6-well plates with Flexitube siRNA constructs (Qiagen) targeting KEAP1 (KEAP1_5 or KEAP1_8) ...
-
bioRxiv - Genomics 2019Quote: ... all GFP-screen samples) in equimolar ratios (by gel-based band densitometry quantification) and then purified using a QiaQuick PCR Purification kit (Qiagen 28104). Purified products were loaded onto a 2% E-gel and gel extracted using a QiaQuick Gel Extraction kit (Qiagen 28704) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA for PCR-based genotyping and piggyBac copy number analysis by ddPCR was isolated via the DNeasy Blood and Tissue Kit (Qiagen 69504). For doxycycline induction of dCas9-KRAB and dCas9-VPR ...
-
bioRxiv - Cell Biology 2022Quote: Total genomic DNA was isolated for 94 samples across cellular lifespan using column based DNeasy blood and tissue kit (Qiagen #69504) and quantified using Qubit dsBR assay (ThermoFisher #Q32850) ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was isolated from a 23 week human fetal heart using Trizol-based dissociation followed by the RNEasy Mini Kit (Qiagen #74104). cDNA was created from this RNA using the iScript Reverse Transcription Supermix (Bio-Rad #1708840) ...
-
bioRxiv - Microbiology 2022Quote: Tissue specimens were combined based on species (e.g. liver and gills) and total RNA was extracted using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) as previously described in [18 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The RNA in the upper aqueous layer was subjected to column-based purification using the Qiagen RNeasy Plus mini kit (Catalog No. 74134, Qiagen, Germany). RNA was reversed transcribed using random hexamer primers with High-Capacity cDNA Reverse Transcription Kit (Catalog No ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA gene was used as internal control for normalization ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18 S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Synthetic Biology 2020Quote: ... For SARS-CoV-2 antigen detection the blots were incubated with 1:2000 Anti-His mouse monoclonal primary antibody (Qiagen, #34660) and then incubated with 1:10000 peroxidase labelled anti-mouse IgG secondary antibody (GE Healthcare) ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR was monitored on Rotor-Gene® Q-Pure Detection System (Software Ver. 2, Qiagen Inc., Valencia, CA, USA) and performed using QuantiFast SYBR® Green PCR Master Mix (Qiagen) ...
-
bioRxiv - Biophysics 2023Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA 27 gene was used as the internal control for normalization ...
-
bioRxiv - Molecular Biology 2019Quote: ... A 1:3 mixture of a QuantiFast SYBR Green PCR Kit (Qiagen) and a FastStart SYBR Green Master (Roche ...
-
bioRxiv - Immunology 2019Quote: ... approximately 25 mg of tissues were homogenized in 2 mL tubes containing 600 μL of Buffer RLT with 2% β-mercaptoethanol and a stainless steel bead (5 mm, Qiagen) using a TissueLyser II system (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... 5) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) with modifications ...
-
bioRxiv - Genomics 2019Quote: ... and BS (2) EpiTect Bisulfite Kit (QIAGEN, Hilden, Germany) respectively according to the manufacturers’ recommendations ...
-
bioRxiv - Neuroscience 2021Quote: ... matching a sequence in intron 22 of the HTT gene (5’-TAATACGTAAGTGTCACAA-3’, custom synthesized by Qiagen) was delivered by intracerebroventricular (ICV ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Systems Biology 2023Quote: ... RNA was extracted using the RNeasy 96-well plate kit (Qiagen, #74181) according to manufacturer’s instructions including the DNase step ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... scaffolds were constructed based on the chloroplast contigs from QIAGEN CLC Genomics Workbench assembly and Velvet assembly (kmer size set to 91 and default settings ...
-
bioRxiv - Microbiology 2023Quote: Plasmids used for protein purification were based on pQE70 (Qiagen). For purification of EsaDEG ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA was extracted from the pooled tissue using a Trizol based protocol followed by on-column DNAse treatment and purification using the Qiagen RNeasy Mini Kit (Qiagen, Valencia, CA). RNAseq libraries were prepared in a single batch by the Bauer Core at Harvard using the KAPA mRNA HyperPrep Kit (Roche ...
-
bioRxiv - Immunology 2022Quote: ... Total DNA was isolated from approximately 200 mg frozen tissue by repeated bead-beating combined with chemical lysis and column-based purification using the QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions (Salonen et al. ...