Labshake search
Citations for Qiagen :
501 - 550 of 10000+ citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed in an Applied Biosystems QuantStudio 3 using the QuantiTect® Multiplex PCR Kit (QIAGEN). The primers and probes used are listed in Table S2 ...
-
bioRxiv - Genetics 2020Quote: ... in a 2 ml Eppendorf (Hamburg, Germany) tube using Stainless Steel Beads (5 mm) and the TissueLyzer (QIAGEN, Venlo, Netherlands). After an incubation time of 5 min ...
-
bioRxiv - Immunology 2019Quote: ... longitudinal muscle/myenteric plexus preparations were homogenized in a 2 ml eppendorf containing 1 ml Trizol and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Cancer Biology 2019Quote: Tumour tissue were collected into 2 ml tubes with pre-chilled steel beads (Qiagen Stainless Steel Beads, 5 mm, 69989) and stored at −80 °C freezer ...
-
bioRxiv - Microbiology 2020Quote: ... Purified extracellular WT and Δtgif2k-b tachyzoites were treated with vehicle or 5 μM sodium arsenite for 2 h at 37°C and total RNA was extracted using RNeasy (Qiagen). The RNA concentration for each sample was measured using Nanodrop One (Thermo Scientific) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... ∼2.5×108 cells (0.5 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Microbiology 2022Quote: ... of 0.2-0.3 was pelleted by centrifugation at 7000 x g for 5 minutes and pellets were resuspended in 1mL of ATGN media and incubated with 2 mL of RNAProtect reagent (QIAgen) for 15 min at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Microbiology 2021Quote: ... up to 200 mg of tissue was disrupted in TRIzol (Lifetechnologies) with 2 x 5 mm stainless steel beads using the TissueLyser (Qiagen) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... up to 200 mg of tissue was disrupted in TRIzol (Lifetechnologies) with 2 x 5 mm stainless steel beads using the TissueLyser (Qiagen) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mosquito bodies and legs were homogenized in phosphate-buffered saline (PBS) supplemented with 20% FBS and 2% penicillin-streptomycin with 5-mm stainless steel beads with a TissueLyser (Qiagen) before RNA isolation ...
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Approximately 50 mg of tissue was homogenised in 500 µl phosphate-buffered saline (PBS) for 2 min at 30 Hz using 5 mm steel beads on a TissueLyser II instrument (Qiagen). Total nucleic acids were extracted using the Nucleo Mag Vet Kit (Macherey & Nagel ...
-
bioRxiv - Plant Biology 2024Quote: ... The fresh leaf discs were transferred to a 2 mL tube containing a 5 mm stainless steel bead and 500 µL buffer RLT (QIAGEN). The leaf discs were disrupted using a TissueLyser LT (QIAGEN ...
-
bioRxiv - Developmental Biology 2020Quote: ... at and after 32-cell stage were extracted using Animal Tissue Direct PCR kit (FOREGENE) and those (~200) of unfertilized eggs and 2-cell embryos were purified using DNeasy® Blood & Tissue Kit (Qiagen). DNA fragments flanking target sites were amplified using primers listed in Supplementary Table S3 ...
-
bioRxiv - Genomics 2021Quote: ... and Vero E6 cells infected with 2 patient virus isolates was converted to cDNA using reverse transcriptase from qiaseq SARS-CoV-2 primer pool (Qiagen kit, cat no. 333896). APOBEC3b (sense ...
-
bioRxiv - Microbiology 2021Quote: Confluent 6-well plates of BAC16-iSLK.RTA cells were lysed using a DNeasy Blood and Tissue Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was isolated from Cac-P4.5 cells (originating from the PtP4.5 selection plate) using the MagAttract HMW DNA Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Worms were washed from each plates and genomic DNA was extracted using Qiagen DNeasy Blood & Tissue Kit (Qiagen) and quantified by Qubit (Invitrogen) ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted from cells grown in 6-well plates using RNeasy Mini Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: CYP124 was crystallized using a sitting drop approach in 96-well crystallization plates with commercially available kits (Qiagen) at 20 °C with 1:1 protein/mother liquor ratio with the ligand concentration of 100 μM ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Cells were collected again using filter plates and subjected to DNeasy 96 Blood and Tissue Kit (Qiagen 69581) (yielding 4-15μg per strain).
-
bioRxiv - Synthetic Biology 2023Quote: Genomic DNA was isolated from Streptomyces plates or liquid cultures using the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Germany). The bead beating was performed using a TissueLyser LT (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from individual wells of 24-well culture plates using a RNeasy Plus Mini Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Genomics 2020Quote: ... before aliquoting into 5 tubes and proceeding with the Qiagen DNeasy Plant Mini Kit (Qiagen; 69104) protocol ...
-
bioRxiv - Biophysics 2022Quote: ... to dephosphorylate 5’ ends.Digested inserts were gel extracted using the QiaQuick gel extraction kit (Qiagen, Germany). Digested and 5’ dephosphorylated vector was purified using the QiaQuick PCR Cleanup kit (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA from 5 embryos was extracted using the RNeasy microRNA isolation kit (Qiagen, Valencia, CA), and the RNA samples were digested on-column with RNase-free DNase I to eliminate genomic DNA ...
-
bioRxiv - Genomics 2022Quote: We extracted RNA from 5 × 105 cells using the QIAGEN RNeasy Mini kit (Qiagen, cat # 74014) with DNase I treatment (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of each reaction mixture was used for amplification with the REPLI-g kit (Qiagen) at 16 °C overnight and cleaned with the DNA Clean & Concentrator kit to yield samples for sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was prepared from approximately 5×106 cells using the DNeasy-96 kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... USA) and detection reagent SYBR Green mix (QIAGEN, Valencia, CA, USA). Gene-specific PCR products were subjected to melting curve analysis and quantified by the 2-ΔΔCt method whereas GAPDH mRNA was determined as the internal control ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 2 hours we extracted the total RNA (RNeasy mini kit, Qiagen, cat. n. 74104) from 40 animals for each of the 3 experimental replicates (total ...
-
bioRxiv - Cell Biology 2020Quote: RNA from 2×107 cells was isolated using the RNeasy Mini Kit (Qiagen, Venlo, Netherlands), cDNA was generated by reverse transcription on CFX96 real-time system (BioRad ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 2 μl sucrose purified virus using the RNeasy mini kit (QIAgen). The RNA was then treated with TURBO DNase (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: Total RNA was extracted from 1–2 million cells using the AllPrep Mini kit (QIAGEN) according to the manufacturer’s instructions and 1 μg of total RNA was used to prepare each RNA-seq library ...
-
bioRxiv - Cancer Biology 2019Quote: ... cfDNA was extracted from 2 ml of plasma using QIAamp Circulating Nucleic Acid Kit (QIAGEN) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was isolated from 2-week-old plant leaves using RNeasy Mini Kit (QIAGEN) Germany ...
-
bioRxiv - Genetics 2022Quote: ... RNA was collected from 2 x 105 pelleted cells using the RNeasy mini kit (Qiagen). qPCR using primers specific for ERAP1 or TNFSF12 were used to validate knockdown relative to 18S rRNA.
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 RNA was quantified by RT-qPCR with the QuantiTect Kit (Qiagen, 204443) with Sarbeco E gene primers and probe in a QuantStudio 3 thermocycler (Applied Biosystems) ...
-
bioRxiv - Systems Biology 2020Quote: RNA was isolated from 2 x 106 cells with the RNeasy Plus Mini kit (Qiagen) and reversely transcribed with SuperScript III (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was run on 2% agarose gel and extracted using QIAquick Gel Extraction Kit (QIAGEN). Fragments and backbone were ligated using T4 DNA ligase (Cat# M0202 ...