Labshake search
Citations for Qiagen :
401 - 450 of 5525 citations for Primary Human Brain Microvascular Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: Total RNA from macrophages or primary tumors was extracted using an RNeasy Mini kit (#74104, Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from primary dissociated cortical neuron cultures using RNeasy Mini Kits (QIAGEN 74104). cDNA was synthesized by reverse transcription using All-In-One 5X RT Master Mix (ABM-G592 ...
-
bioRxiv - Neuroscience 2023Quote: In vitro samples: RNA isolation from primary hippocampal neurons using RNeasy plus micro kit (Qiagen, #74034), according to the manufacturer’s recommendations.
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from primary microglia or astrocyte using the RNeasy Plus Mini kit (Qiagen). The cDNA was subsequently synthesized with an Invitrogen SuperScript® IV First-Strand Synthesis System ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human organoids using RNeasy Mini Kit with DNase treatment (QIAGEN), and synthesis of cDNA was conducted with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Physiology 2020Quote: ... RNA from human islets (∼150 for each donor) was extracted with RNeasy Mini Kit (Qiagen) and was reverse transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... For the RT² Profiler™ PCR Array Human Epithelial to Mesenchymal Transition kit (EMT) (Qiagen), RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... human PAAS proteome was imported into Ingenuity Pathway Analysis (IPA) software (QIAGEN, 2020 released version)[84] for canonical pathway analysis ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from pigskin and human skin swabs using a DNeasy PowerSoil kit (Qiagen). Procedural extraction control blanks (swabs with sterile water ...
-
bioRxiv - Immunology 2023Quote: Human nasal swab samples were inactivated with 350 µls RLT buffer (Qiagen, Cat No. 79216) containing 1% β-mercaptoethanol for a minimum of 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and human islets was isolated using RNeasy Mini or Micro kits (Qiagen, Valencia, CA, USA). Reverse transcription was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... The autophagy screening was performed using the RT2 Profiler™ PCR Array Human Autophagy (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2020Quote: ... The primary antibodies were used at the following dilutions: 1:1000 anti-penta-His mouse monoclonal (Qiagen), 1:5000 anti-cMyc mouse monoclonal (Sigma) ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from 3D cultures of mouse primary keratinocytes using RNeasy Micro Kit (QIAGEN, UK), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-His Western blots were performed using Penta-His mouse monoclonal IgG1 as primary antibody (Qiagen, #34660) at 1:2000 dilution ...
-
bioRxiv - Microbiology 2019Quote: ... and Western blot analysis was performed as previously described (30) using a primary anti-his antibody (Qiagen) and a secondary Alexa Fluor 700 goat anti-mouse antibody ...
-
bioRxiv - Neuroscience 2022Quote: RNA purification from both IPSC and primary mouse cortical cultures were done using RNeasy 96 Kit (Qiagen) according to the manufacturer protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein bands were transferred to a nitrocellulose membrane and probed with primary antibodies [mouse anti-His (Qiagen) to detect CAT ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from human and mouse kidney samples was harvested using the RNeasy Mini Kit (Qiagen). Total RNA isolation from cultured cells was extracted using Trizol reagent (Ambion ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using miRCURY LNA miRNA Human Panel I according to manufacturer’s instructions (Exiqon/Qiagen). The data was analyzed using GenEX software (MultiD ...
-
bioRxiv - Immunology 2021Quote: Pathway-specific primer mixes (Rat Antibacterial Response, PBR-148Z, and Human Antibacterial Response, PBH-148Z; Qiagen) were used for preamplification and qPCR arrays (Rat Antibacterial Response ...
-
bioRxiv - Microbiology 2021Quote: ... while rodent and human samples were eluted in 100 µl of buffer AE (Qiagen, Hilden, Germany). Samples were stored at −20°C before PCR.
-
bioRxiv - Cell Biology 2022Quote: Total RNA was isolated from murine and human monocytes with the RNeasy Plus Micro Kit (Qiagen), and then 200 ng of RNA was reverse transcribed using the iScript RT Supermix (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was then extracted from human blood plasma using the QIAmp Circulating Nucleic Acids kit (Qiagen), eluted in 60-μl elution buffer (10 mM Tris-Cl ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from mouse or human whole blood using RNA blood mini kit (Qiagen). Isolated RNA was converted to complementary DNA (cDNA ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was added to the Human Toll-like receptor signaling pathway RT2 Profiler PCR array (Qiagen) and run on an iCycler MyiQ (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Targets were included if biochemically confirmed using human tissue or non-species methods (sourced from QIAGEN’s curated Ingenuity Knowledge Base ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Cancer Biology 2020Quote: ... human FLMs and adjacent normal tissue was performed using the AllPrep DNA/RNA Mini Kit (Qiagen). Whole exome sequencing was performed by Novogene using their standard protocols ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA of mouse and human intestinal tissue was isolated using the RNeasy Mini Kit (Qiagen) and total RNA of mouse mesenteric fat was isolated using the RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human induced astrocytes (>day 30 of differentiation) were harvested in RLTplus Lysis buffer (Qiagen, 1053393). Total RNA was isolated using the RNeasy micro/mini plus kit (Qiagen ...
-
bioRxiv - Physiology 2023Quote: ... and grown to confluency and transfected with human Leptin constructs using Effectene kit (Cat# 301427, QIAGEN).
-
bioRxiv - Cancer Biology 2023Quote: gDNA was isolated from human sarcoma models and controls using the QIAamp DNA Mini Kit (Qiagen). Library preparation was performed by the Functional Genomics Laboratory (FGL) ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from human sarcoma models and controls using the RNeasy Mini Kit (Qiagen). Library preparation was performed by the Functional Genomics Laboratory (FGL) ...
-
bioRxiv - Genetics 2024Quote: ... and aligned to a human reference sequence GRCh38/hg38 by using CLC Genomics Workbench v20 (Qiagen). The TPM (transcript per million ...
-
bioRxiv - Molecular Biology 2021Quote: ... UVSS and CS primary skin fibroblasts was isolated using the QIamp® DNA mini kit (Cat#51304; Qiagen) and used for microarray-based analysis of genome wide DNA methylation levels in two different sets (see Fig.1A for detail of cells used for each set) ...
-
bioRxiv - Cancer Biology 2020Quote: Genomic DNA extraction was performed in 26 primary mammary tumors using a QIAamp FFPE kit (Qiagen, Dusseldorf, Germany) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10-15 μl of primary or re-amplified WTA product was purified using QIAquick PCR Purification Kit (QIAgen) according to the manufacturer’s instruction with several changes ...
-
bioRxiv - Genomics 2022Quote: ... sampled primary leaf of each plant and extracted DNA with DNeasy Plant Mini Kit (Qiagen KK, Tokyo, Japan).
-
bioRxiv - Microbiology 2022Quote: ... Primary-pools of ants were homogenized with 2 ceramic beads (2.8mm) in 350 µl QIAzol Lysis Reagent (Qiagen) for 2×2min at 30Hz in a TissueLyser II (Qiagen) ...
-
bioRxiv - Neuroscience 2020Quote: ... frozen fragments of human cortex were homogenized with a motorized hand pestle in RLT lysis buffer (Qiagen) and qPCR was performed as described in qPCR section.