Labshake search
Citations for Qiagen :
351 - 400 of 10000+ citations for Estrone 3 Glucuronide E1G ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... miR-67 (miR control) or empty vector at a ratio of 1:3 using a lipofection protocol (Effecten, Qiagen) and processed at DIV15 ...
-
bioRxiv - Bioengineering 2023Quote: Each body part (legs and thorax) was homogenized individually for 3 × 1 minute at 30 Hertz using TissueLyser (Qiagen) and glass beads (#11079110 ...
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...
-
bioRxiv - Cell Biology 2020Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts isolated from fresh and cryopreserved tissue from 3 different donors in technical replicates using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... RNA from each Xenopus embryo (n=2-3/condition) was separately extracted and purified using the RNeasy Micro Kit (Qiagen; Venlo, Netherlands) and microarray measurements were performed using the GeneChip Xenopus laevis Genome 2.0 Array (Affymetrix ...
-
bioRxiv - Microbiology 2020Quote: ... and each amoeba-adapted and non-adapted population derived from days 3 and 42 using the QIAamp DNA mini kit (Qiagen, Venlo, Netherlands) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted from each sample (n=3 WT and n = 3 Fgf9null) using Trizol/chloroform and spin-column assembly with on-column DNase treatment (RNeasy mini kits; Qiagen Germantown, MD). We assessed the quality of RNA using fragment analysis to obtain RNA integrity number (RIN ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted from control and treated samples at 3 and 24 hr with three biological replicates (Figure S1) using Qiagen RNeasy Plant Mini kit (Qiagen, Hilden, Germany), with an on-column DNase treatment ...
-
bioRxiv - Genomics 2020Quote: ... 3 μl of the PCR products was mixed and purified using the QIAquick PCR Purification Kit (Catalog No. 28104, Qiagen, Hilden, Germany).
-
bioRxiv - Cancer Biology 2020Quote: ... the pCMV-Neo-Bam p53 R248W vector containing the ampr gene was purified from the transfected SKOV-3 cells using the Qiaprep Miniprep Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 3) human iPSC-derived neurons was prepared using miRNeasy Micro Kit (Qiagen Cat. 217084), based on manufacturer’s procedures ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, PSEN1A246E, and PSEN1H163R (replicates, n = 3) human iPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen, Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: DNA was extracted from 3 ml of each raw milk sample using the PowerFood™ Microbial DNA Isolation Kit (MoBio Laboratories, Qiagen, USA) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: mRNA samples from ANS4-GFP and ANS4-GFP cells co-cultured with bEnd.3 (for 72 hours) were isolated using RNeasy Plus Micro Kit (QIAGEN, cat# 74034). Next-generation whole transcriptome Illumina sequencing (HiSeq4000 ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Blood was obtained for lymphocyte preparation 3-5 days after the fifth immunization and RNA was prepared from lymphocytes using the RNeasy kit (Qiagen, Valencia, CA). A VHH-display phage library was prepared essentially as described previously [70] following each of the rounds of alpaca immunization ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was isolated from HFC (n = 3) and LFC (n = 4) tumor samples using the RNeasy Plus Universal Mini Kit (QIAGEN, Valencia, CA) and RNA quality was confirmed using an Advanced Analytical Fragment Analyzer ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... striatal and retinal RNA from the same R6/1 mice was pooled (3-4 samples per genotype) and further processed using the clean-up protocol of the RNeasy Mini Kit (Qiagen, Hilden, Germany), which also included on-column DNase I treatment ...
-
bioRxiv - Immunology 2023Quote: 4.5×106 - 7.3×106 live control or oxPAPC-treated Tregs were harvested on day 3 of culture and RNA was isolated using RNeasy Plus Mini Kit (Qiagen Cat #: 74134) according to manufacturer instruction ...
-
bioRxiv - Evolutionary Biology 2022Quote: RNA was isolated from abdomens from 3 days post injection pupae collected during the experimental infection experiments using the RNeasy Mini Kit (Qiagen, Hilden, Germany) following manufacturers’ protocol including a DNAse incubation step and quantified using a Nanodrop ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA was extracted from 3 mL overnight cultures of each strain (see Strains Cultivation) using the DNeasy PowerSoil Pro Kit from Qiagen (Hilden, Germany) per manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... Fifteen milligrams of liver were homogenized in 200 µL of a 3:3:2 solution of acetonitrile:isopropanol:water (MeCN:IPA:H2O) in ceramic bead tubes (1.4 mm, Qiagen #13113-50) using a TissueLyzer II (Qiagen #85300) ...
-
bioRxiv - Biochemistry 2020Quote: Cells seeded in 6 well plates were grown in 5% FBS to a confluency of 70% before RNA extraction using the RNEasy mini kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... All HA positive clones were amplified in a 6 well plate and genomic DNA isolated using Qiagen DNAeasy blood and tissue kit as per manufactures instructions (Qiagen, Germantown, MD) (Cat #69504) ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was purified 1-3 dpi from mock- or POWV-infected hBMECs or hPCs using RLT lysis buffer and RNeasy columns (Qiagen). Purified RNA was quantitated ...
-
bioRxiv - Genomics 2022Quote: ... the supernatants were mixed with Sigma HIS-Select Nickel Affinity Gel (at a ratio of 3:1) equilibrated in lysis buffer before being added into a polypropylene column (Qiagen). After extensive washing with a cold lysis buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted from pooled (n=10) embryonic zebrafish and pooled (n=3) adult (> 1 year) heart samples by QIAGEN RNEasy Lipid Tissue Extraction kit according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: Bacterial RNA was isolated from LB cultures at OD600nm 1 and 3 in biological replicates using the QIAzol lysis reagent (Qiagen). The quantity of the bacterial RNA samples was measured on a NanoDrop ND1000 system and their quality analyzed on the Agilent 2100 Bioanalyzer system with the Agilent RNA 6000 Nano kit protocol (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The LNA gapmers for lnc-FLii-1 and lnc-LSAMP-3 were designed and purchased along with negative control LNA from Qiagen. For transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2023Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Genetics 2019Quote: ... cfDNA was extracted from 2 mL of plasma at baseline and from 3 mL of plasma post-treatment using QIAamp DNA purification kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... The miRNAs were modified by polyadenylation at the 3’ end and then reverse transcribed into the cDNA of miRNA using the miScript PCR Starter Kit (#218193, Qiagen, Valencia, CA, USA) with an oligo dT primer (with a universal tag) ...
-
bioRxiv - Plant Biology 2021Quote: ... and sunflower_KTI _R (5’ – CTACTCAGATTGAACAGAAGCCAC- 3’were designed and used in a PCR reaction with total DNA extracted (DNeasy Plant Mini Kit, Qiagen, Valencia CA USA) from sunflower leaf tissue ...
-
bioRxiv - Plant Biology 2021Quote: RNA samples were isolated from seedlings at each time point with 3 biological replicates using Qiagen Plant RNA extraction kit (Qiagen; catalog no. 74904). A total of 18 cDNA libraries were prepared following the standard BGISEQ-500 RNA sample preparation protocol and sequenced by the DNBseq platform (BGI ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Microbiology 2022Quote: Total mouse lung RNA was extracted at days 0 and 3 post-challenge using the RNeasy Mini Kit as described above (QIAGEN, Cat. No 74004) and purified with the QIAquick PCR Purification Kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resultant backbone without the Puromycin gene was purified using the QIAquick PCR & Gel Cleanup Kit (Qiagen 28506. A DNA block (Table 3) containing the Blasticidin resistance gene sequence was synthetised (Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: Ni-NTA agarose beads (Qiagen 70666-3)
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...