Labshake search
Citations for Qiagen :
151 - 200 of 10000+ citations for Estrone 3 Glucuronide E1G ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... RNA samples from 3 independent cultures for each strain (Chr_dam and Chr_gfp) were extracted with RNeasy miniprep kit (Qiagen). Primers used are listed in Table S1 ...
-
bioRxiv - Genetics 2020Quote: ... 4 dpe on-tet n=3) was extracted using the Qiagen RNeasy Mini Plus Kit (Qiagen, Hilden, Germany), which includes a column-based genomic DNA removal step ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from an aliquot of 3 x 106 cells using the RNeasy Plus Kit (Qiagen). cDNA was synthesized from extracted RNA using the iScript cDNA Synthesis Kit (BioRad ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... genomic DNA was isolated from HEK293T cells 3 days after transfections using the Gentra Puregene Cell Kit (Qiagen) and was diluted to 10 ng/μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed 3 times with PBS and had their genomic DNA extracted with the QIAamp DNA mini kit (QIAGEN). Sequencing libraries were prepared at GenomeScan (Netherlands ...
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from 0 or 3% CSE-treated bronchospheres using the Qiagen RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA was extracted from 3-week-old plants using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA was then isolated for each biological replicate (3) using an RNeasy Lipid Tissue Mini kit (Qiagen). DNA contamination was removed using TURBO DNA-free (Ambion) ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from 3 dpf zebrafish AB larvae (50 fish) using RNAeasy Plus Kit (Qiagen 74134). cDNA was synthesized using SuperScript IV Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed in an Applied Biosystems QuantStudio 3 using the QuantiTect® Multiplex PCR Kit (QIAGEN). The primers and probes used are listed in Table S2 ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Microbiology 2021Quote: Confluent 6-well plates of BAC16-iSLK.RTA cells were lysed using a DNeasy Blood and Tissue Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was isolated from Cac-P4.5 cells (originating from the PtP4.5 selection plate) using the MagAttract HMW DNA Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Worms were washed from each plates and genomic DNA was extracted using Qiagen DNeasy Blood & Tissue Kit (Qiagen) and quantified by Qubit (Invitrogen) ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted from cells grown in 6-well plates using RNeasy Mini Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: CYP124 was crystallized using a sitting drop approach in 96-well crystallization plates with commercially available kits (Qiagen) at 20 °C with 1:1 protein/mother liquor ratio with the ligand concentration of 100 μM ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Cells were collected again using filter plates and subjected to DNeasy 96 Blood and Tissue Kit (Qiagen 69581) (yielding 4-15μg per strain).
-
bioRxiv - Synthetic Biology 2023Quote: Genomic DNA was isolated from Streptomyces plates or liquid cultures using the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Germany). The bead beating was performed using a TissueLyser LT (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from individual wells of 24-well culture plates using a RNeasy Plus Mini Kit (Qiagen) per the manufacturer’s instructions ...
-
Immune profiling in M. tuberculosis infection enables stratification of patients with active diseasebioRxiv - Immunology 2019Quote: Supernatants from QFT and TruC tubes were analyzed for IFNγ by standard ELISA (Qiagen) and values were expressed in IU/mL ...
-
bioRxiv - Cell Biology 2019Quote: ... KIF4A siRNA 5’-CAGGTCCAGACTACTACTC-3’ against the 3’-UTR was obtained from QIAgen, and an optimised siRNA pool for KIF22 (KID ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic DNA from 3×107 sorted GFP+ cells was extracted using the Blood & Cell Culture DNA Maxi Kit (Qiagen). Amplification of sgRNA regions from the extracted genome and the original sgRNA plasmid library ...
-
bioRxiv - Molecular Biology 2020Quote: ... while method-3 was a modified protocol of the DNeasy PowerMax Soil Kit (Cat.No. 12988-10) provided by Qiagen (based on communication exchanged with the manufacturer) ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was purified from cell passage number 3 using the RNeasy RNA purification kit (Qiagen Cat. No. 75142). A260:280 ratio > 2 and RIN > 9.
-
bioRxiv - Immunology 2021Quote: Bacterial plasmid DNA was extracted from a 3 ml overnight culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Next ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted at 3 hpi and 24 hpi with the RNeasy Mini Total RNA extraction kit (Qiagen). SARS-CoV-2 RNA was detected with the CDC assay kit (IDT ...
-
bioRxiv - Bioengineering 2022Quote: ... transfected cells were harvested on Day 3 and genomic DNA was extracted using DNeasy Blood & Tissue Kit (QIAGEN # 69506). The region surrounding EMX1 target site was amplified with EMX1-F ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNAs from batch of 3-5 embryos were extracted with the Rneasy® Micro Kit (Qiagen, Valencia CA). Relative quantitative PCR was performed on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... Seedlings of 3-week-old plants were used to extract total RNAs using the RNeasy Plant Mini Kit (Qiagen). Total RNAs were treated with amplification-grade RNase-free DNase I (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were harvested 3 days later by direct application of buffer RLT from the RNeasy mini kit (Qiagen 74104).
-
bioRxiv - Plant Biology 2022Quote: 3 μg total RNA was extracted from each flower bud sample using Tiangen Polysaccharide and Polyphenol Kit (QIAGEN, Germany). After passing the quality inspection ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA was extracted from 50-80 mg of surface-sterilised (70% EtOH, 0.1% Triton X-100) and 3-days germinated seeds with RNeasy Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 100 mg of seedlings at 3 dpg by means of the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... oxydans wild-type cultures at OD600 0.3 units (Exp) or 3 units (Sta) using the RNeasy Mini Kit (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The excess dsDNA was removed by 3 rounds of PCR clean up with QIAquick PCR Purification Kit (Qiagen, 28106).
-
bioRxiv - Microbiology 2024Quote: ... used for DNA extraction of minipig blood and (NM-3) one negative control for the kit DNeasy PowerWater (Qiagen) used for the DNA extraction of water samples ...
-
bioRxiv - Microbiology 2019Quote: ... 1 ml RLT buffer (Qiagen RNA Isolation Kit) + 10 μl β-mercaptoethanol was added and vortexed and a phenol chloroform extraction followed by an ethanol precipitation was carried out ...
-
bioRxiv - Immunology 2020Quote: Ni-NTA plates (Qiagen) were loaded with 2 μg/mL of SARS-CoV-2 S protein in TBS for 2 h at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... three kits were used: (1) Qiagen DNeasy Blood & Tissue Kits (Qiagen, cat. no. 69504) for DNA extraction and (2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 12-273 BM cells at 80% confluence in 6 well plates using the RNeasy Mini Kit (Qiagen 74104). 600 ng of RNA was subjected to DNase I treatment and reverse transcription ...
-
bioRxiv - Genomics 2021Quote: ... in a 15 ul reaction volume in 96-well plates or with the Repli-g Single Cell kit (Qiagen) in a 10 ul reaction volume in 384-well plates ...
-
bioRxiv - Biochemistry 2020Quote: CYP124–SQ109 was crystallized by a sitting drop approach in 96-well crystallization plates with commercially available kits (Qiagen) at 20 °C with 1:1 protein/mother liquor ratio with the ligand concentration of 100 μM ...
-
bioRxiv - Cell Biology 2022Quote: Cells were seeded at 800,000 in 60 mm plates and 24 h later RNA was isolated (Qiagen RNeasy Kit). 1 ug of RNA was reverse transcribed (Applied Biosystem) ...
-
bioRxiv - Cell Biology 2022Quote: Cells were seeded at 800,000 in 60 mm plates and 24 h later RNA was isolated (Qiagen RNeasy Kit). 1 μg of RNA was reverse transcribed (Applied Biosystems™ High-Capacity cDNA Reverse Transcription Kit) ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was isolated from cells in 96-well plates using the Qiagen FastLane Cell Probe Kit (QIAGEN, 216413), according to the manufacturer’s instructions to a final volume of 40 μL per well ...