Labshake search
Citations for Qiagen :
401 - 450 of 10000+ citations for Estrone 3 Glucuronide E1G ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Cell Biology 2022Quote: To synthesize cDNA from 1 μg RNA the Quantitect kit (Qiagen) was used according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: RNA (1 µg) was extracted with the RNeasy Kit (QIAGEN, 74106) and treated with DNase I following the manufacturer’s instructions (QIAGEN ...
-
bioRxiv - Microbiology 2020Quote: ... PCR#1 product was purified using Minielute PCR purification kit (Qiagen) and a second round of PCR amplification was performed with gene-specific primers R2 and forward F2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 ml binding buffer (provided in Qiagen PCR purification kit, #28106) and 20 µl of 3 M sodium acetate pH 5.5 (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... from 1 x 107 cells using the RNeasy Mini Kit (Qiagen) and the TruSeq Stranded mRNA kit (Illumina ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 colonies using a DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). We used DNeasy Blood & Tissue Kits (QIAGEN ...
-
bioRxiv - Cell Biology 2019Quote: ... 1.2×106 cells were plated into each well of a 6-well plate and transfected with Sns and Eff-1 constructs (200ng each) using Effectene (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... catalysis was measured using a previously described assay (22) in which hexahistidine-tagged PARP-1 was immobilized on Ni(II)-NTA-coated plates (Qiagen) in the presence of NAD+/biotinylated-NAD+ (Trevigen) ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... we transfected S2 cells in each well of a 6-well plate with 1 µg each of HA/GFP-tagged constructs using Effectene (Qiagen). After incubation for 3 days ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were sorted into 96-well plates containing lysis buffer with proteinase K solution in PKD buffer (1:16) (Qiagen) and were stored at -80ºC ...
-
bioRxiv - Microbiology 2023Quote: ... a single GFP+ or GFP-J-Lat 11.1 cell was sorted directly into each well of a 96-well PCR plate containing the pre-amplification mastermix consisting of 1 μL One-step RT-PCR enzyme (QIAGEN), 5 μL 5× One-step RT-PCR buffer (QIAGEN) ...
-
bioRxiv - Cell Biology 2021Quote: Drosophila S2R+ cells were transfected with 0.5 µg DNA (pAC-Gal4+pUASp-GEM, or pAC-LAMP1-GFP 77) in 12-well plate using Effecetene transfection kit (Qiagen, Cat. # / ID: 301425) and then were plated 48 hours after transfection on concanavalin A-coated glass coverslips 78 ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-qPCR was performed in 384 well plates on an Applied Biosystems 7900HT Fast Real-Time PCR system using the QuantiTect Virus Kit (Qiagen, Redwood City, CA) and SARS-CoV-CDC RUO primers and probes (Integrated DNA Technologies (IDT) ...
-
bioRxiv - Microbiology 2022Quote: ... and mutants recovered from selected LB plates after collection from the ligature (oral) and fecal (gut) samples (output) using the DNeasy Blood & Tissue Kit (Qiagen Sciences, Germantown, MD) [36] ...
-
bioRxiv - Cancer Biology 2019Quote: Cells were seeded in 6-well plates 24 h prior to isolation of total RNA using a RNeasy Mini Kit (QIAGEN, Santa Clara, CA). mRNA levels for EMT-related genes were determined using the validated primer sets (SA Biosciences Corporation ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μL of plasma/EV suspension were mixed with 1000 μL Qiazol and 1 μL of a mix of 3 synthetic spike-in controls (Qiagen, Germany). After a 10-minute incubation at room temperature ...
-
bioRxiv - Genomics 2019Quote: DNA from EndoC-βH1 cells exposed or not to IL-1β and IFN-γ for 48h as described above (3 replicates per condition) was extracted using QIAamp DNA Mini kit (Qiagen, Venlo, The Netherlands). 1 μg DNA aliquots (n=3 ...
-
bioRxiv - Plant Biology 2022Quote: RNA samples were isolated from seedlings at each time point with 3 biological replicates using Qiagen Plant RNA extraction kit (Qiagen, Germany; Cat. No. 74904). A total of 18 cDNA libraries were prepared following the standard BGISEQ-500 RNA sample preparation protocol and sequenced by the DNBseq platform (BGI ...
-
bioRxiv - Neuroscience 2023Quote: ... Dissociated microvascular cells were stained for flow cytometric analysis or were additionally processed with myelin removal beads (Miltenyi 130-069-731) and 3 sequential positive selections with CD31 microbeads (Miltenyi 130-097-418) for RNA isolation (Qiagen RNeasy Micro Kit 74004). cDNA library preparation used Oligo-dT at 60 million clusters/sample (University of Chicago Genomics Facility).
-
bioRxiv - Immunology 2022Quote: ... on 96-well Ni-NTA plates (Qiagen) for 2h at RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... and released in PyroMark Q24 plate (Qiagen) pre-loaded with 0.375 μM of sequencing primer ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Genetics 2021Quote: ... S2 cells were seeded at 1 × 106 cells/ml in a 6-well plate and transfected using Effectene (Qiagen, Germantown, MD). For mobility shift assay (Figure 4) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Biochemistry 2022Quote: ... and FdxE−CYP143 (200–250 µM) were crystallized in 96-well plate using a sitting-drop method with commercially available kits from Qiagen (NeXtal Classics II screen) and Molecular Dimensions (Structure screens 1 and 2 ...
-
bioRxiv - Microbiology 2023Quote: ... Colonies were picked onto fresh plates and genomic DNA extraction was carried out using the QIAamp® DNA Mini Kit (QIAGEN; cat. number: 51306) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼8 ml PCR product (azide-DNA:2xbiotin-DNA = 1:1) was purified using HiSpeed Plasmid Maxi kit (Qiagen) in 1 ml NaHCO3 (pH 8.3) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and was run on miScript miRNA PCR Array Human Ovarian Cancer plates (Qiagen, MIHS-110ZE-4, 384 well plate). PCR plates were read the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: RNA was extracted from 1 million cells with RNeasy mini Kit (Qiagen) following the manufacturer’s instructions and with DNase treatment on column ...
-
bioRxiv - Plant Biology 2021Quote: ... Genomic DNA (1 μg) isolated using a DNeasy plant mini kit (Qiagen) was used for library construction ...
-
bioRxiv - Plant Biology 2021Quote: ... nks1-1 and nks1-2 using RNeasy Plant mini kit (74904, QIAGEN). cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691 ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (1 μg) was was extracted using miRNeasy Mini Kit (Qiagen) and applied to either miR-based or mRNA based reverse transcription ...
-
bioRxiv - Microbiology 2020Quote: ... and IFN-stimulated DF-1 and CEF using the RNeasy kit (Qiagen) according to the manufacturer’s instructions as previously described48 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 µg RNA was reverse transcribed using QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacture’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µg RNA was reverse transcribed using miScript II RT kit (Qiagen) as per protocol before qPCR using miScript SYBR Green kit (Qiagen ...
-
bioRxiv - Genetics 2020Quote: ... rad54-1 and rad54-2 plants using RNeasy Plant mini Kit (QIAGEN), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... for less than 1×104 cells or the RNeasy kit (Qiagen #74004) otherwise ...