Labshake search
Citations for Qiagen :
251 - 300 of 1575 citations for Recombinant Human Interleukin 3 Receptor Alpha Low Affinity His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... for GST-tagged protein or Ni-NTA Agarose beads (QIAGEN) for His-tagged protein ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were blocked with 5% milk in PBST (Phosphate buffer saline, 0.05% Tween 20) and incubated with monoclonal mouse anti-His antibody (Penta His, Qiagen, dilution 1:1000) according to the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... the mouse anti-penta-His antibody (Qiagen; Catalog #34660) was used at a 1:2,000 dilution in 3% BSA in PBS with sodium azide ...
-
bioRxiv - Genetics 2019Quote: ... or anti-tetra His (0.1 μg/ml Qiagen 34670) were used as primary antibodies ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-His is a peroxidase-conjugated antibody (Qiagen). The membranes were incubated for 1 h at room temperature with horseradish peroxidase-conjugated goat anti-rabbit IgG (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... PABPC1-His was bound to Ni-NTA resin (Qiagen), washed by 1x PBS (10 mM imidazole added ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or mouse anti-RGS-His antibody (Qiagen; cat # 34610) at 1:5000 dilution followed by goat anti-rabbit-HRP conjugate (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse antibodies against the His-tag (1:1000, Qiagen), rabbit antibodies against the C-terminal region of the collagen VI α1 chain (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-penta-His antibody (34660; Lot# 136244018; Qiagen); mouse anti-Myc tag mAb ...
-
bioRxiv - Microbiology 2020Quote: ... The anti-His antibody conjugated to horseradish peroxidase (Qiagen) was used at a dilution of 1:5,000 ...
-
bioRxiv - Microbiology 2021Quote: ... 1:1,000 dilution of α-His-HRP antiserum (Qiagen), or 1:1,000 dilution of α-OmpA antiserum (Antibody Research Corporation ...
-
bioRxiv - Plant Biology 2022Quote: ... and NoFa-ICL was the Penta-His antibody (Qiagen) at 1:4000 in TBST ...
-
bioRxiv - Immunology 2022Quote: ... then incubated with the primary antibody anti-His (Qiagen) at a concentration of 1:2500 in a solution of 3% non-fat milk in TBS-T overnight at 4 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Anti-Penta-His antibody was purchased from Qiagen (Germany).
-
bioRxiv - Biophysics 2024Quote: ... were functionalized with biotinylated α-penta-His antibody (Qiagen, Hilden Germany or R&D Systems ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the lysate was subjected to Ni2+-NTA affinity chromatography (Qiagen) followed by size exclusion chromatography using a Superdex 200 column (GE Healthcare ...
-
bioRxiv - Biochemistry 2019Quote: ... Proteins were purified by Ni2+-affinity (Ni-NTA agarose, Qiagen) then passed over an anion-exchange column (Hitrap Q HP ...
-
bioRxiv - Biochemistry 2020Quote: ... Following immobilised metal-affinity chromatography with Ni-NTA resin (Qiagen), the 6 x His-tag was removed via incubation with thrombin protease overnight at 4 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein was affinity-purified using Ni-NTA agarose (Qiagen #301210), and exchanged into severing buffer I (SBI ...
-
bioRxiv - Biochemistry 2020Quote: ... NT-hFMRP was purified using Ni-NTA affinity chromatography (Qiagen). GST-hFMRP RGG ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was purified using Ni-NTA affinity columns (Qiagen) and subsequently purified by gel filtration using a HiLoad Superdex 75 pg column (GE) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The supernatants were purified using an affinity Ni2+ column (Qiagen). All proteins were eluted by imidazole of 8 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... It was then purified by Ni-NTA affinity chromatography (Qiagen)(50mM Tris pH 8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and further purified with affinity column (RNeasy Mini Kit, Qiagen) following the manufacturer’s protocols ...
-
bioRxiv - Immunology 2019Quote: ... Proteins were purified by affinity chromatography on NiNTA agarose (Qiagen), followed by FPLC on MonoQ (GE Healthcare ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein was isolated by Ni-NTA affinity chromatography (Qiagen) and eluted with 50 mM Tris buffer pH 7.5 ...
-
bioRxiv - Bioengineering 2019Quote: ... Immobilized metal affinity chromatography (IMAC) using Ni-NTA matrix (Qiagen) was employed for purification purposes ...
-
bioRxiv - Cell Biology 2020Quote: ... 2ml of packed Ni-NTA affinity chromatography resin (Qiagen, USA) was calibrated with 10 volumes of lysis buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... proteins were affinity purified on Ni-NTA agarose beads (Qiagen). Proteins eluted from Ni-NTA beads by stepwise addition of increasing concentrations of 50-300 mM imidazole in a buffer containing 20 mM HEPES pH 7.4 ...
-
bioRxiv - Biochemistry 2023Quote: ... and purified using its affinity for Ni-NTA agarose (Qiagen). The eluate was further purified by ion-exchange and size-exclusion chromatography steps ...
-
bioRxiv - Biochemistry 2022Quote: ... and affinity-purified using Ni-nitrilotriacetic acid (NTA) agarose (QIAGEN) as previously described (Kim et al. ...
-
bioRxiv - Biochemistry 2022Quote: V1ab4 was purified by Ni-NTA-sepharose affinity chromatography (Qiagen), followed by a Q-Sepharose ion exchange column ...
-
bioRxiv - Plant Biology 2023Quote: ... or Ni-NTA affinity agarose beads (30210, QIAGEN, Venlo, Netherlands).
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were purified by Ni2+-affinity (Ni-NTA agarose, Qiagen) then passed over an anion-exchange column (Hitrap Q HP ...
-
bioRxiv - Bioengineering 2023Quote: ... 86 and purified using immobilized metal-affinity chromatography (Qiagen, 30230) and size-exclusion chromatography ...
-
bioRxiv - Cell Biology 2023Quote: ... His6-UBXN7 was purified by Ni2+-NTA affinity chromatography (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were affinity-purified with Ni-NTA Agarose Resin (Qiagen), followed by cation exchange chromatography using Source 15S Resin (Cytiva) ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were affinity-purified with Ni-NTA Agarose Resin (Qiagen), followed by cation exchange chromatography using Source 15S Resin (Cytiva) ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were affinity-purified with Ni-NTA Agarose Resin (Qiagen), followed by affinity-purification with amylose resin (New England Biolabs) ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant plasmids were then isolated (MiniPrep, Qiagen) and sequenced (DNA Sequencing Facility ...
-
bioRxiv - Biophysics 2021Quote: ... His10-tagged SecYEG was isolated using Ni2+-NTA agarose resin (Qiagen). Once bound to Ni2+-NTA beads ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the tagged DNA was cleaned with the Min Elute kit (Qiagen) and processed to a sequencing library ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2019Quote: ... A 10 nM solution of biotinylated penta-His antibody (Qiagen) was incubated for 10 min on the neutravidin-coated surface and excess unbound antibody removed (22 ...
-
bioRxiv - Bioengineering 2020Quote: ... Anti-Penta-His Alexa Fluor 488 conjugate was from Qiagen.
-
bioRxiv - Microbiology 2022Quote: ... and His-PutA was purified with Ni-column chromatography (Qiagen). The purified His-PutA protein (50 μg ...
-
bioRxiv - Biochemistry 2021Quote: Penta-His HRP conjugate was purchased from QIAGEN (Hilden, Germany). Anti-BepA (Narita et al. ...
-
bioRxiv - Immunology 2022Quote: ... and incubated with Penta-His-biotin conjugate 1:5000 (Qiagen) overnight ...