Labshake search
Citations for Qiagen :
2701 - 2750 of 4028 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... genomic DNA was isolated 3 or 8 days after editing by a QIAamp DNA Mini Kit or Micro Kit (QIAGEN). The genomic region flanking the CRISPR/Cas9 cleavage site was PCR-amplified ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were washed 3 times with PBS to eliminate unbound FVVs and RNAs were extracted using RNeasy plus mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... The process was repeated twice (3 in total) and the leukocyte enriched pellet was lysed in 350 µl RLT buffer (Qiagen) and stored at −20 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... The tissue was then ground to a fine powder using 3/16 inch (4.76mm) ball bearings in a Tissuelyzer II (Qiagen, Germany) in the presence of dry ice in the pockets around tube holders ...
-
bioRxiv - Plant Biology 2023Quote: ... the resulting dried leaves were then ground to powder with a 3-mm glass bead placed in a tube with a Tissuelyser mill (Qiagen). The ground samples were incubated at 4°C in DNA extraction buffer (200 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 20 ovaries were dissected from 3-day-old adult females and DNA extraction was performed using the Gentra Puregene Blood and Tissue kit (Qiagen). DNA samples used for PacBio sequencing were produced using the protocol described in (Ellegaard et al. ...
-
bioRxiv - Neuroscience 2024Quote: Genomic DNA was isolated from ipsilateral and contralateral ventral midbrain hemispheres at 3 months after AAV-GFP or AAV-Cre-GFP injections using the DNeasy Blood and Tissue kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... tissues were placed in 300μL of sterile PBS containing sterile glass beads and mechanically lysed at a frequency of 20 shakes per seconds for 3 minutes in a TissueLyser II (Qiagen). Negative controls consisted of tubes containing PBS and beads but no sample ...
-
bioRxiv - Microbiology 2024Quote: ... mosquitoes were homogenized in 500 μl ice-cold 1X Phosphate Buffered Saline buffer with two ice-cold steel bearing balls (3 mm diameter, LOUDET) using a TissueLyser II (Qiagen) and clarified through centrifugation ...
-
bioRxiv - Bioengineering 2024Quote: Total RNA was isolated from untreated or RNP-transfected plerixafor-mobilized HD and SCD HSPCs (n=3 for each group) using the RNeasy Kit (QIAGEN) that includes a DNAse treatment step ...
-
bioRxiv - Plant Biology 2022Quote: ... frozen in liquid nitrogen, ground to a fine powder (3 mm glass beads added to tissue, ground using tissue lyser (TissueLyser II, QIAGEN), 30/second frequency ...
-
bioRxiv - Microbiology 2023Quote: ... fresh 0.35 g/L proteinase K) during two rounds of 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). Total RNA was converted into complementary DNA (cDNA ...
-
bioRxiv - Cell Biology 2023Quote: Cells were lysed in 3% SDS in 10mM Tris pH = 7.5 by pipetting then centrifuge through a Qiashredder column (Qiagen #79656). Protein concentrations were determined by BCA assay (Thermo Fisher Scientific #23225) ...
-
bioRxiv - Cell Biology 2023Quote: ... All tissue samples were then centrifuged at top speed for 3 minutes and total RNA was purified from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNAs were purified from 3 mL overnight cultures grew at optimum temperature (30 °C or 37 °C) by Dneasy Blood & Tissue Kits (QIAGEN). Additionally ...
-
bioRxiv - Biochemistry 2023Quote: ... K-R or K-Q mutant cells (post PNKP 3’-UTR siRNA transfection and GO/Bleo treatment) was performed using the QiaAmp DNA Micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was isolated from 2000 cells per replicate and 3 replicates per treatment by the micro RNeasy kit (QIAGEN) for both mouse muscle satellite cells and ZeMPCs ...
-
bioRxiv - Genetics 2022Quote: RNA from cortex and hippocampus derived ex vivo cultures was extracted from 3 biological replicates for three time points (DIV3, DIV15, DIV31) using RNeasy Plus Mini Kit (Qiagen). cDNA was synthesized using a SuperScript IV Reverse Transcriptase cDNA synthesis kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... centrifuged to 300 xG for 3 mins and dissociated using RLT buffer as recommended by RNeasy Plus Mini Kit (74134, Qiagen). All RNA isolation steps were done as recommended by the RNeasy kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting 1683 bp product spanning the 3’ end of MYO2 upstream of the integration site through the 3’ untranslated region was then isolated using a PCR purification kit (Qiagen), and mutations were confirmed by sequencing using primer 5’- CTCATTTGTGGTGTTTGCTC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... BioConcept) in TAE buffer (3-07F03-I, BioConcept) and products were extracted using the QIAquick Gel Extraction Kit (28706, Qiagen) and Sanger sequenced by Microsynth (Balgach ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial cells were harvested from the surface of the cheese agar by using a sterile razor blade and were then immediately placed into 3 mL of RNAProtect Bacteria Reagent (Qiagen) and frozen at -80C until RNA extraction ...
-
bioRxiv - Microbiology 2023Quote: DNA extraction was carried out with 37 mg of freeze-dried mycelium using the Nucleospin Microbial DNA kit in combination with 3 mm tungsten carbide beads (Qiagen) for tissue disruption in a MM 301 vibratory mill ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was harvested from 2-3 million HIV-dreGFP infected Jurkat cells exposed to EPZ-719 (500nM) or control (DMSO) using a RNEasy kit (Qiagen). RNA quantity and quality were then analyzed by nanodrop and Tapestation (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... and Chl523R (5’ CCY YMC GTA TTA CCG CAG CT 3’) targeting the 16S rRNA gene on a QIAcuity One digital PCR device (Qiagen) as recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... the FT and Eluate fractions (90 µL each) were mixed with 10 µL 3 M sodium acetate and applied to a QIAquick spin column (Qiagen). Purified DNA was visualized a 1.3% agarose / 0.5x TBE gel and SYBR Green staining ...
-
bioRxiv - Cell Biology 2023Quote: Cells were cultured on a glass substrate and soft hydrogel for 3 days and total RNA was extracted using RNeasy mini kit (Qiagen). RNA quantity and purity were verified using 2200 TapeStation system (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from cell lines in 3 biological replicates after each CRISPR/Cas9 oncogene downregulation using QIAzol (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... GFP+ and GFP- nuclei were sorted using a BD AriaFACS III (University of Washington Pathology Flow Cytometry Core) into a PCR tube strip containing 3 µL of REPLI-g Advanced Single Cell Storage buffer (Qiagen). Whole genome amplification (WGA ...
-
bioRxiv - Biochemistry 2024Quote: ... NEO1 3’UTR was isolated from genomic DNA isolated from cultured HEK-293T using DNeasy Blood and Tissue kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final samples of 3 or 30 million cells were collected and genomic DNA was extracted (DNeasy blood and Tissue kit, Qiagen). Next ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting homogenates were centrifuged at 13,000 rotations per minute (rpm) for 3 min and RNA in the supernatant was purified using the RNase Mini Kit (Qiagen). A NanoDrop spectrophotometer was used to measure the concentration of RNA in each sample ...
-
bioRxiv - Genomics 2024Quote: DNA was extracted from approximately 3 ml of whole blood using the Gentra Puregene Blood Kits (#158467; Qiagen, Hilden, Germany), following the “Whole Blood” subsection in the manufacturer-provided handbook ...
-
bioRxiv - Genetics 2024Quote: RNA was isolated from 10 wandering third-instar larvae (3 biological replicates per genotype; WT, pr-set720 and parp-1C03256) using RNeasy lipid tissue mini kit (Qiagen). RNA samples were flash-frozen in liquid nitrogen and sent to Novogene for library preparation and sequencing ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Developmental Biology 2021Quote: ... were first frozen in liquid nitrogen and then homogenized with a 5 mm ∅ metal bead (Qiagen) for 2 min at 40 Hz using TissueLyser LT (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... using stainless steel beads (5 mm mean diameter) and a TissueLyser LT adapter (Qiagen, Hilden, Germany) for 5 min at 50 Hz ...
-
bioRxiv - Immunology 2021Quote: ... the supernatant/Sepharose bead slurry was passed through a 5 ml polypropylene gravity flow column (Qiagen). The column was washed with 1 column volume of PBS before being eluted with 9 ml of Elution Buffer (0.1M Glycine/HCl buffer ...
-
bioRxiv - Pathology 2019Quote: ... The Pparα deletion was confirmed with PCR and HotStar Taq DNA Polymerase (5 U/μl, Qiagen) using the following primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... and resuspended in 10 mM Tris pH8 (500 μL) with 5 μL RNase A (Qiagen 19101) for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131 ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the tube together with a 5 mm stainless steel bead (Qiagen, Maryland, USA). The sample was homogenized for two minutes at 30 Hz using a TissueLyser II (Qiagen ...
-
bioRxiv - Neuroscience 2019Quote: ... Frozen tissues were placed into tubes containing a 5 mm stainless steel bead (Qiagen, Courtaboeuf, France) and 1 ml of Trizol reagent (Life Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... small RNA-enriched total RNA was treated twice with 5 μl of RNase-free DNase (Qiagen) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Biochemistry 2019Quote: ... The soluble fraction was loaded onto a column containing 5 ml Ni-NTA superflow resin (Qiagen), pre-equilibrated with buffer A ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Microbiology 2021Quote: ... sorokiniana were ground with two stainless steel beads (5 mm) using a TissueLyser (Qiagen, Hilden, Germany) at 30 Hz for 1 minute at room temperature and soaked in 1 ml of 100 mM sodium acetate buffer pH 5.0 at 70°C overnight ...