Labshake search
Citations for Qiagen :
201 - 250 of 10000+ citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The qPCR assays were performed using QuantiNova SYBR green (Qiagen) as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... Validated qPCR primers and primer assays (Qiagen, see Table 1) were used together with QuantiTect SYBR Green PCR kit (QIAGEN ...
-
bioRxiv - Genomics 2022Quote: ... qPCR was performed using miScript assays (Qiagen, Cat No: 218075) The cDNA was diluted to approximately 40 ng/ul ...
-
bioRxiv - Immunology 2020Quote: ... Gene expression analysis was performed with primer assays from Qiagen [IL-10] and Eurofins [IL-12α ...
-
bioRxiv - Developmental Biology 2023Quote: ... together with the miRCURY LNA miRNA PCR Assay (Qiagen, 339306) on a StepOne Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Developmental Biology 2023Quote: ... and RNU6-2 (Hs_RNU6-2_11 miScript Primer Assay, Qiagen, MS00033740) as housekeeping miRNA.
-
bioRxiv - Neuroscience 2023Quote: ... Pre-validated Qiagen QuantiTect Primer Assays (Qiagen, Germantown, MD, USA) were used for cut (QT00501389) ...
-
bioRxiv - Genetics 2024Quote: ... dme-miR-14-3p miRCURY LNA miRNA PCR Assay (QIAGEN), and dme-U6-snRNA custom miRCURY LNA miRNA PCR Assay (QIAGEN).
-
bioRxiv - Molecular Biology 2024Quote: ... qPCR was performed with predesigned primers (Qiagen, QuantiTect Primer Assays).
-
bioRxiv - Biochemistry 2021Quote: ... peritoneal membrane sections (80 mg) were dissociated in 1 ml buffer RLT (QIAGEN) supplemented with β-mercaptoethanol (1:100 v:v ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membrane-bound genomic DNA was digested with RNase-Free DNase Set (Qiagen, 79254). First strand cDNA was synthesised using a ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs ...
-
bioRxiv - Bioengineering 2020Quote: ... submerging the membrane in 100μL elution buffer (10mM Tris-Cl, pH 8.5, QIAGEN) and heating to 50°C for 10 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were harvested from the transwell membranes using 350µl RLT buffer (#74104; Qiagen) for downstream RNA extraction ...
-
bioRxiv - Bioengineering 2021Quote: ... Holders with 50 nm membrane filters were connected to a vacuum manifold (Qiagen) and washed with 10 mL of PBS by applying vacuum ...
-
bioRxiv - Cancer Biology 2021Quote: ... holders with 50-nm membrane filters were connected to a vacuum manifold (Qiagen), and washed with 5-10 mL of PBS buffer by applying vacuum ...
-
bioRxiv - Microbiology 2023Quote: ... The filtration membranes were preserved in 250 μl of RNALater (Qiagen; Catalog #76104) for 5 minutes prior to storage at −80°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... miScript primer assays for Hs_miR-22_1 and Hs_RNU6-2_11 from Qiagen were used.
-
bioRxiv - Cell Biology 2020Quote: ... mRNA expression level was evaluated using specific QuantiTect Primer Assays (QIAGEN) specific for NUPR1 (QT00088382) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR was performed using SYBR Green QuantiTect Primer Assay (Qiagen) according to manufacturer’s instructions in a 7900HT Fast-Real Time PCR System Instrument (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primers (IDT) were designed using the PyroMark Assay Design software (Qiagen)
-
bioRxiv - Cancer Biology 2020Quote: ... The ChIP primers were purchased from Qiagen (EpiTect ChIP PCR assay) and used for qPCR analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the appropriate bespoke designed miScript Primer Assays (Qiagen, Crawley, UK). Real-time PCR was undertaken using a LightCycler® 96 system (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers were designed with the PyroMark Assay Design 2.0 software (Qiagen), based on the Ensembl GRCh37 assembly (See Supplementary Table 10) ...
-
bioRxiv - Cell Biology 2023Quote: ... All primers were purchased from miScript Primer Assays (Qiagen, Valencia, CA) and GAPDH mRNA expression of each sample was used as normalization.
-
bioRxiv - Cancer Biology 2024Quote: ... GAPDH was used as a control (Hs_Gapdh_3_SG QuantiTect Primer Assay, Qiagen). Each sample was tested in three technical replicates.
-
bioRxiv - Neuroscience 2024Quote: ... miRCURY LNA assays for qPCR of miRNA were purchased from Qiagen, and TaqMan probes were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... AT2R qRT-PCR was performed using RT2 qPCR Primer Assay (Qiagen). AT2R ...
-
bioRxiv - Genetics 2024Quote: ... with dme-miR-8-3p miRCURY LNA miRNA PCR Assay (QIAGEN), dme-miR-14-3p miRCURY LNA miRNA PCR Assay (QIAGEN) ...
-
bioRxiv - Genetics 2024Quote: ... and dme-U6-snRNA custom miRCURY LNA miRNA PCR Assay (QIAGEN).
-
bioRxiv - Cancer Biology 2024Quote: ... The following primer pairs were from Qiagen (RT2 qPCR primer assay): GPI (PPH00897C) ...
-
bioRxiv - Plant Biology 2022Quote: ... Blocking of the membranes was performed in anti His HRP conjugate blocking buffer (Qiagen). After blocking at room temperature for 2 h ...
-
bioRxiv - Microbiology 2024Quote: ... the membrane was blocked in Anti·His HRP Conjugate blocking buffer (Penta·His HRP Conjugate, Qiagen) at 4 °C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... The individual miRNA assays used in this study were purchased from Qiagen and used with the miRCURY LNA miRNA PCR Starter Kit (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... with 1 µL cDNA using the following oligonucleotides (QuantiTect Primer Assays, Qiagen): Gli1 (Gli1 ...
-
bioRxiv - Immunology 2022Quote: ... These primers were designed using the PyroMark Assay Design 2.0 software (Qiagen). PCR amplicons were pyrosequenced using the PyroMark Q48 system and analyzed with PyroMark Q48 Autoprep software.
-
bioRxiv - Neuroscience 2020Quote: ... Mag and Mbp were designed using PyroMark Assay Design Software 2.0 (Qiagen) (Supplementary Figure 3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Pyrosequencing primers were designed using the PyroMark Assay Design Software 2.0 (Qiagen). 500ng of genomic DNA was subjected to bisulfite conversion using the EpiTect Bisulfite Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... These primers were designed using the PyroMark Assay Design 2.0 software (Qiagen). PCR amplicons were pyrosequenced using the PyroMark Q48 system and analyzed with PyroMark Q48 Autoprep software.
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins used for inhibition assays were purified using Ni-NTA resin (Qiagen) followed by size exclusion column chromatography (ÄKTA pure ...
-
bioRxiv - Microbiology 2023Quote: ... QuantiTect Primer assays [ACTB (QT00095431) and CDKN1A (QT00062090)] we purchased from Qiagen. ACTB was used for normalization ...
-
bioRxiv - Cancer Biology 2024Quote: ... For two-way qPCR (analysis of MAPK11; Hs_MAPK11_1_SG QuantiTect Primer Assay, Qiagen); cDNA was first synthesised with High Capacity cDNA Reverse Transcription Kit (Fisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... For one-way qPCR (analysis of MAP3K1, Hs_MAP3K1_1_SG QuantiTect Primer Assay, Qiagen); Luna® Universal One-Step RT-qPCR Kit was used ...
-
bioRxiv - Cell Biology 2023Quote: ... and Mm_miR-29c were the miScript primer assays pre-designed by Qiagen. The mature microRNA sequences were 5’UAGCACCAUCUGAAAUCGGUUA for Mm_miR-29a ...
-
bioRxiv - Cancer Biology 2022Quote: ... SMNDC1 primers (Hs_SMNDC1_1_SG QuantiTect Primer Assay QT00014035) were from Qiagen (Hilden, Germany). PCR was performed with Hot Start Taq Polymerase (M0495S ...
-
bioRxiv - Bioengineering 2023Quote: ... and primers from miRCURY LNA miRNA PCR Assays (Catalog No. 339306, Qiagen) for hsa-miR-21-5p (GeneGlobe ID YP00204230) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The primers were designed using the PyroMark Assay Design Software 2.0 (Qiagen) (Supplementary Table S6) ...
-
bioRxiv - Genetics 2024Quote: A four-color assay using the QIAcuity One 5plex Device (Qiagen 911021) was used to measure excision frequency and specificity by single-step digital PCR as illustrated in Figure S16.
-
bioRxiv - Biochemistry 2021Quote: ... and the membrane suspension was mixed with 1 ml of Ni-NTA Superflow resin (Qiagen) per 1mg of GFP–His8 and incubated for 3 hours at 4 °C ...
-
bioRxiv - Biophysics 2022Quote: ... pH 7.2) and dialyzed against the same buffer overnight (10 kDa membrane, ThermoScientific or Qiagen) at room temperature ...
-
bioRxiv - Biophysics 2024Quote: ... membranes were incubated under soft shaking with Penta-His antibody (Penta His HRP Conjugate; Qiagen) for 1 h with 0.5 % (w/v ...