Labshake search
Citations for Qiagen :
201 - 250 of 1519 citations for ETS Related Transcription Factor Elf 3 ELF3 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... and synthesized probes using a reverse transcription kit (Qiagen) with added DIG labeled nucleotides ...
-
bioRxiv - Biochemistry 2024Quote: ... and reverse-transcribed using Quantitect reverse transcription kit (Qiagen) as per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was synthesized using Quantitect Reverse Transcription kit (Qiagen). Transcript quantification was done using Applied Biosystems Taqman probes and ABI 7500 real-time quantitative PCR system ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was obtained with QuantiTect Reverse Transcription Kit (Qiagen) following manufacturer instructions ...
-
Targeting properdin - Structure and function of a novel family of tick-derived complement inhibitorsbioRxiv - Immunology 2021Quote: ... the Penta-His HRP Conjugate Kit (Qiagen) was used following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... The Penta-His HRP Conjugate Kit (Qiagen) was used for detection of His-tagged proteins according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... we used anti RGS HIS6 HRP(QIAGEN) Cat.n°/ID 34450.
-
bioRxiv - Cell Biology 2022Quote: ... These annotated gene names were then used with IPA (Kramer et al., 2014) (QIAGEN Inc. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pathway analyses were conducted using GSEA (v4.0) (Subramanian et al., 2005) and IPA (Qiagen). Pathway and gene list overlaps were plotted using BioVenn (Hulsen et al. ...
-
bioRxiv - Developmental Biology 2024Quote: LFC and padj data for Ingenuity Pathway Analysis (QIAGEN IPA, (Krämer et al., 2014)) was acquired by running DESeq2 with apeglm LFC shrinkage as described in the DGE section ...
-
bioRxiv - Physiology 2020Quote: ... or the QuantiTect PCR Kit with self-designed primers for neuronal factors (Qiagen, Germany) (Supplementary Table 3) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and then reverse transcribed using QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: cDNA synthesis was conducted by QuantiTect Reverse Transcription Kit (Qiagen). qPCR was performed with PerfeCTa SYBR Green FastMIX Low ROX (Quanta Bioscience) ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was synthesized using QuantiTect Reverse Transcription Kit (QIAGEN, 205311). qPCR and data analysis were performed as described previously (51) ...
-
bioRxiv - Genetics 2021Quote: ... cDNA synthesis was done with QuantiTect Reverse Transcription Kit (Qiagen) and qRT-PCR reactions were run with the SYBR Green reagent (Roche ...
-
bioRxiv - Genetics 2021Quote: ... cDNA synthesis was done with QuantiTect Reverse Transcription Kit (Qiagen). Splicing of unc-43 and unc-104 mRNAs was analyzed by running PCR products in agarose gels ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized with the Quantinova Reverse Transcription Kit (Qiagen). Quantitative PCR was performed in triplicate on a Step One Plus (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: Quantitative reverse transcription-PCR (qRT-PCR; Rotor-Gene Q; Qiagen) was performed to check the specificity of cDNA products derived from Cap-Seq library preparation ...
-
bioRxiv - Genetics 2020Quote: ... cDNA was synthesized using the QuantiTect Reverse Transcription Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Reverse transcription was conducted using the Omniscript RT Kit (Qiagen) or the Sensiscript RT kit (Qiagen) ...
-
bioRxiv - Bioengineering 2020Quote: ... and reverse transcription was performed with Omniscript RT Kit (Qiagen). The PCR amplifications were conducted using Taq DNA Polymerase with Standard Taq buffer (New England Biolabs) ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was generated with the Quantitect Reverse transcription kit (Qiagen). Using the 2-ΔΔCt method ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was synthesized using the Quantitect Reverse Transcription Kit (Qiagen), followed by PCR using the primers ACACGCTTGGGAATGGACAC and CCATGGGAAGATGTTCTGGG and separation on 4% agarose ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was transcribed using the QuantiTect reverse transcription kit (Qiagen) from all the samples and amplified by PCR using Q5 master mix (New England Biolabs ...
-
miR-206 inhibits estrogen-induced proliferation and invasion of ER-α36 positive gastric cancer cellsbioRxiv - Cancer Biology 2021Quote: ... the miScript Reverse Transcription Kit (Qiagen, Inc., Valencia, CA, USA) was utilised for the reverse transcription of 1 μg total RNA according to manufacturer instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized using the Quantitect Reverse Transcription Kit (Qiagen) and stored at −20°C for further use ...
-
bioRxiv - Cancer Biology 2022Quote: ... and cDNAs were produced using QuantiTect reverse transcription kit (QIAGEN). qRT-PCR was performed using PowerUp SYBR Green Master Mix (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... First strand cDNA was synthesized using Reverse Transcription Kit (Qiagen). Quantitative real time PCR was performed using SYBR Green and the following primers from Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized using the QuantiTect Reverse Transcription Kit (Qiagen). Real time quantitative PCR (qPCR ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: cDNA synthesis was performed using Quantitect Reverse Transcription kit (Qiagen) and quantified with the iTaq™ Universal SYBR® Green Supermix PCR Kit in Rotor Gene Q (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... and cDNA prepared using the Quantitech Reverse Transcription kit (Qiagen). SYBR-green based quantitative PCR assays were deigned and optimised for HLA-C and Hprt ...
-
bioRxiv - Genetics 2020Quote: ... RNA was reverse-transcribed using QuantiTect Reverse Transcription Kit (Qiagen). The qRT-PCR was performed using LightCycler® 480 SYBR Green I Master (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... and reverse transcribed using the Quantitect Reverse transcription Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was prepared using the QuantiTect Reverse Transcription Kit (Qiagen). qPCR to assess transcript abundance of Irf4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was performed using miScript II RT reagents (Qiagen) -HiFlex buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse-transcribed with Quant iNova Reverse Transcription kit (Qiagen). qPCR was performed using Quant iNova SYBR Green PCR kit (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was generated using the QuantiTect Reverse Transcription Kit (QIAGEN) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... and cDNA synthesized using the QuantiTect Reverse Transcription Kit (Qiagen). TaqMan primers IL-6 ...
-
bioRxiv - Bioengineering 2023Quote: ... cDNA was synthesized using the Quantitect Reverse Transcription Kit (Qiagen) and stored at -20°C for further use ...
-
bioRxiv - Developmental Biology 2023Quote: ... we prepared cDNA using a QuantiTect Reverse Transcription Kit (Qiagen). Quantitative RT-PCR was performed using an ABI Prism 7900HT PCR Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Genetics 2023Quote: ... cDNA was synthesized using the QuantiTect Reverse Transcription Kit (Qiagen) using equivalent amounts of RNA per sample ...
-
bioRxiv - Physiology 2024Quote: ... cDNA was synthesized using the Quantitect Reverse Transcription Kit (Qiagen). Primers were designed using Primer Designing Software (NCBI ...
-
bioRxiv - Physiology 2023Quote: ... and used for cDNA synthesis (QuantiTect Reverse Transcription Kit, Qiagen). RT-qPCR was performed (QuantiTect SYBR Green PCR Kit ...
-
bioRxiv - Neuroscience 2024Quote: ... and reverse transcription was performed with the Quantitect kit (QIAGEN). Library cDNA was subjected to PCR for Illumina NGS sequencing as described below in the in vivo screening methods.
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was generated using the QuantiTect Reverse Transcription kit (Qiagen), using 2µg RNA in each reaction ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized using the QuantiTect Reverse Transcription Kit (QIAGEN), and real-time PCR was performed on a LifeTechnologies QuantStudio 7 real-time PCR system using SYBR™ Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Physiology 2023Quote: ... or the Omniscript Reverse Transcription Kit (Qiagen, 205113, Hilden, Germany) and oligo(dT)15 primers (Promega ...
-
bioRxiv - Genetics 2022Quote: ... cDNA was synthesized using Quantitect Reverse Transcription kit (QIAGEN, # 205313) starting from 1 μg of RNA ...
-
bioRxiv - Immunology 2022Quote: ... was synthesized using a commercial QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by cDNA synthesis using QuantiTect Reverse Transcription Kits (Qiagen). Real-time PCR was conducted using QuantiNova SYBR® Green PCR Kits (Qiagen ...